ID: 1202254761 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Y:22909422-22909444 |
| Sequence | CCTTCTATTCAGAGGGATGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1202254755_1202254761 | 25 | Left | 1202254755 | Y:22909374-22909396 | CCTTCTTGTCAAGTTTTTTCCTA | No data | ||
| Right | 1202254761 | Y:22909422-22909444 | CCTTCTATTCAGAGGGATGATGG | No data | ||||
| 1202254757_1202254761 | 6 | Left | 1202254757 | Y:22909393-22909415 | CCTACAAATTGGATTATTAAATT | No data | ||
| Right | 1202254761 | Y:22909422-22909444 | CCTTCTATTCAGAGGGATGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1202254761 | Original CRISPR | CCTTCTATTCAGAGGGATGA TGG | Intergenic | ||
| No off target data available for this crispr | |||||