ID: 1202254761

View in Genome Browser
Species Human (GRCh38)
Location Y:22909422-22909444
Sequence CCTTCTATTCAGAGGGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202254755_1202254761 25 Left 1202254755 Y:22909374-22909396 CCTTCTTGTCAAGTTTTTTCCTA No data
Right 1202254761 Y:22909422-22909444 CCTTCTATTCAGAGGGATGATGG No data
1202254757_1202254761 6 Left 1202254757 Y:22909393-22909415 CCTACAAATTGGATTATTAAATT No data
Right 1202254761 Y:22909422-22909444 CCTTCTATTCAGAGGGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202254761 Original CRISPR CCTTCTATTCAGAGGGATGA TGG Intergenic
No off target data available for this crispr