ID: 1202260716

View in Genome Browser
Species Human (GRCh38)
Location Y:22967432-22967454
Sequence TATAATCCCCAGTGGAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202260716_1202260719 22 Left 1202260716 Y:22967432-22967454 CCCTGCTTCCACTGGGGATTATA No data
Right 1202260719 Y:22967477-22967499 AATGATATGACTCTCTTGCCTGG 0: 10
1: 17
2: 34
3: 84
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202260716 Original CRISPR TATAATCCCCAGTGGAAGCA GGG (reversed) Intergenic
No off target data available for this crispr