ID: 1202260719

View in Genome Browser
Species Human (GRCh38)
Location Y:22967477-22967499
Sequence AATGATATGACTCTCTTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 10, 1: 17, 2: 34, 3: 84, 4: 300}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202260714_1202260719 28 Left 1202260714 Y:22967426-22967448 CCTGGACCCTGCTTCCACTGGGG No data
Right 1202260719 Y:22967477-22967499 AATGATATGACTCTCTTGCCTGG 0: 10
1: 17
2: 34
3: 84
4: 300
1202260718_1202260719 14 Left 1202260718 Y:22967440-22967462 CCACTGGGGATTATAGCTTTTCT No data
Right 1202260719 Y:22967477-22967499 AATGATATGACTCTCTTGCCTGG 0: 10
1: 17
2: 34
3: 84
4: 300
1202260716_1202260719 22 Left 1202260716 Y:22967432-22967454 CCCTGCTTCCACTGGGGATTATA No data
Right 1202260719 Y:22967477-22967499 AATGATATGACTCTCTTGCCTGG 0: 10
1: 17
2: 34
3: 84
4: 300
1202260717_1202260719 21 Left 1202260717 Y:22967433-22967455 CCTGCTTCCACTGGGGATTATAG No data
Right 1202260719 Y:22967477-22967499 AATGATATGACTCTCTTGCCTGG 0: 10
1: 17
2: 34
3: 84
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202260719 Original CRISPR AATGATATGACTCTCTTGCC TGG Intergenic
904260407 1:29284514-29284536 ACTGATATGGCTCCTTTGCCAGG - Intronic
905200473 1:36312527-36312549 AATGATATGTCTGTCTTCACAGG - Intronic
906200395 1:43956538-43956560 AATGACCTGACTCTCTCCCCAGG + Exonic
908375003 1:63527561-63527583 CATGATATGGATCTTTTGCCAGG - Intronic
909702952 1:78548100-78548122 AAAAATAAGATTCTCTTGCCTGG + Intergenic
912455608 1:109794811-109794833 AGTGTTAGGACTGTCTTGCCAGG + Intergenic
912703313 1:111894581-111894603 AATAGTTTGACTCTCTTCCCGGG + Intronic
914256072 1:145961878-145961900 AATGAGATGTCTCTCTTGCAGGG - Exonic
914896624 1:151681011-151681033 AAGGATATGAATGTCCTGCCAGG - Intronic
916189449 1:162165024-162165046 AAGAAAATGACTCCCTTGCCTGG + Intronic
916324811 1:163545156-163545178 AAAGATAAAACTTTCTTGCCAGG - Intergenic
920532499 1:206714036-206714058 AATGACATCACTATCTAGCCAGG - Intronic
922336480 1:224622715-224622737 AATGTTGTGAGGCTCTTGCCAGG + Intronic
923206066 1:231760055-231760077 ATTCATGTGCCTCTCTTGCCGGG + Intronic
924378154 1:243434964-243434986 AATGATGTTACACTTTTGCCTGG + Intronic
1063973729 10:11398855-11398877 AATGATATCCATCTCTTGCTGGG + Intergenic
1065864092 10:29898502-29898524 AATGAAACGACACACTTGCCAGG - Intergenic
1067270125 10:44784391-44784413 AATGATATTCATGTCTTGCCTGG + Intergenic
1068277201 10:54815692-54815714 AATGGCATGACTTTGTTGCCTGG - Intronic
1068467557 10:57414388-57414410 AATGATATAAATTTCTTCCCAGG - Intergenic
1069824045 10:71244482-71244504 AAGGATATGACTCTTCTGCCTGG - Intronic
1070501682 10:77078652-77078674 AATCCTATCACTCACTTGCCTGG + Intronic
1071710668 10:88045926-88045948 AATGATATTACACTCTGGCCGGG - Intergenic
1073095701 10:100978488-100978510 TATGACATGTCTCTCATGCCTGG + Intronic
1074373345 10:112918616-112918638 GATGAAATGACTCTCTGGACTGG + Intergenic
1077780844 11:5327943-5327965 AATGACATGACTATCTTTACTGG - Intronic
1079817968 11:25086435-25086457 AATGAAATACCTCTCTTTCCTGG - Intergenic
1080178098 11:29391864-29391886 TCTAATATGACTCTCTTGCTGGG - Intergenic
1080330833 11:31135454-31135476 ACTAACATAACTCTCTTGCCAGG - Intronic
1081911697 11:46704216-46704238 AATGATACCAATCTCTTCCCTGG - Intronic
1088459311 11:110065695-110065717 CATGATATGCCTCTCCTGCAAGG + Intergenic
1095369759 12:41453080-41453102 AATGGCATGGCTCTTTTGCCTGG - Intronic
1098309238 12:69132026-69132048 AATGACATGAGGCTCTTGTCAGG - Intergenic
1099542170 12:83925974-83925996 AATGAAATGAATTACTTGCCTGG + Intergenic
1102284375 12:111643701-111643723 AATGATATGACACTATTGCTAGG + Exonic
1105842539 13:24267200-24267222 AATAGTGTGACTCTCTTCCCTGG + Intronic
1108397058 13:49999497-49999519 AATGAAATGGCTCCATTGCCTGG - Intronic
1111898039 13:94165804-94165826 AATAATATGATTCTGTTGCAGGG + Intronic
1112170390 13:96966944-96966966 AATGATATGGCTCTGATGACTGG - Intergenic
1114511217 14:23262867-23262889 AATGGTATGCCTGCCTTGCCTGG - Intronic
1117026530 14:51626077-51626099 AATTCTATGACTCTATTTCCAGG - Intronic
1118417508 14:65558032-65558054 AACCATAAGACTCTCTTGGCTGG + Intronic
1118757551 14:68855817-68855839 AATCTTATGACTCTCCTGACAGG - Intergenic
1119482229 14:74965257-74965279 ACTGATGTGACTCACTTCCCAGG - Intergenic
1120010926 14:79413394-79413416 GATGATATGACTTCTTTGCCTGG + Intronic
1124265649 15:28231557-28231579 CATGATATGACACTGTTGCTGGG + Intronic
1128713675 15:69891338-69891360 AATGATTTTTCTCTATTGCCAGG + Intergenic
1128861255 15:71075487-71075509 CATGGTCTCACTCTCTTGCCCGG - Intergenic
1130563601 15:84977381-84977403 GAGGATTTGACTCCCTTGCCTGG + Intergenic
1131769432 15:95718915-95718937 CAGGATCTCACTCTCTTGCCTGG + Intergenic
1135649504 16:24193609-24193631 AAAGAGATGATTCTCTTGGCTGG - Intronic
1137009216 16:35306904-35306926 GGTGATGTGACTCTCCTGCCTGG - Intergenic
1137034713 16:35559948-35559970 GGTGATATGACTCTCTTGCCTGG - Intergenic
1137034941 16:35561919-35561941 GGTGATGTGACTCTCCTGCCTGG - Intergenic
1137035416 16:35565640-35565662 GATGATGTGACTCTTCTGCCAGG - Intergenic
1137036104 16:35571233-35571255 ATTGATTTTACTCTCTTGCCTGG - Intergenic
1137036169 16:35571903-35571925 GGTGCTGTGACTCTCTTGCCAGG - Intergenic
1142691433 17:1608289-1608311 GATCAGGTGACTCTCTTGCCTGG + Intronic
1143614922 17:8044042-8044064 CAGGGTCTGACTCTCTTGCCCGG - Intronic
1144100853 17:11941074-11941096 AATGATTTGAATCTCAAGCCTGG - Intronic
1146627161 17:34443593-34443615 AATTATAGGACTCTCTTAGCTGG + Intergenic
1148068843 17:44894342-44894364 CAAGATCTCACTCTCTTGCCAGG - Intronic
1148924815 17:51074806-51074828 AAAGGTATGACTCTCTGGACTGG + Intronic
1152834171 17:82519160-82519182 AATGACATGACTCGCTAGCCAGG + Intergenic
1203164162 17_GL000205v2_random:78676-78698 AATGATGTGACTCTTTTCCTGGG - Intergenic
1203164217 17_GL000205v2_random:79109-79131 AGTGATTTGACTTTTTTGCCTGG - Intergenic
1153251476 18:3126597-3126619 AATGACGTGACTCTCTTACAAGG + Intronic
1155824683 18:30425005-30425027 AAGGACATGACTCTCTTGTTAGG + Intergenic
1156024389 18:32635097-32635119 TATGGGATGACTCTTTTGCCAGG - Intergenic
1157859332 18:51126400-51126422 AAGAATTTGACTCTCTTGGCTGG + Intergenic
1159952880 18:74497487-74497509 AATCATGTTACTCCCTTGCCAGG + Intronic
1161570201 19:5026340-5026362 GATGATCTGGCTCTGTTGCCTGG + Intronic
1163884206 19:19951456-19951478 CATGCTATGACACTCTAGCCTGG + Intergenic
1163987531 19:20967747-20967769 AATGATTTGACTCTCCTGCCTGG + Intergenic
1163987896 19:20970347-20970369 GGTGATGTGACTCTCCTGCCTGG + Intergenic
1163987952 19:20970702-20970724 GGTGATATGCCTCTCCTGCCAGG + Intergenic
1164041038 19:21492889-21492911 AGTGATCTGACTGTCTTGTCTGG + Intergenic
1164078252 19:21840295-21840317 AGTGATTTGACTCTCCTGCCTGG - Intronic
1164078346 19:21841348-21841370 GGTAATATGACTCTCCTGCCTGG - Intronic
1164078598 19:21843269-21843291 AGCGATTTGACTCTCCTGCCTGG - Intronic
1164085870 19:21901973-21901995 AGTGATTTGACTCTTTTGCTTGG + Intergenic
1164086579 19:21908032-21908054 GGTTATGTGACTCTCTTGCCTGG + Intergenic
1164086838 19:21910679-21910701 AGTGATTTGACTCTCTTGTTGGG + Intergenic
1164087471 19:21916782-21916804 AGTGATTTGACTCCTTTGCCTGG + Intergenic
1164087738 19:21919137-21919159 AGTGATTTGTCTCTCTTGCTTGG + Intergenic
1164087862 19:21920233-21920255 GGTGATGTGACTCTCCTGCCTGG + Intergenic
1164088572 19:21927618-21927640 AGTGATTTGACTCTCCTGCCTGG + Intergenic
1164088746 19:21928939-21928961 AATGATGTTACTCTCCTGCCTGG + Intergenic
1164097953 19:22028803-22028825 AATGTTGTGACTCTCCTGCCTGG - Intergenic
1164098680 19:22034929-22034951 AATGATGTGACTCTCTTGCCTGG - Intergenic
1164100303 19:22048815-22048837 AGTAATTTGACTCTCCTGCCTGG - Intergenic
1164108742 19:22134908-22134930 AATAATTTGACTCTCTTGCTTGG + Intergenic
1164118550 19:22245152-22245174 AATGATGTGACTTTCCTTCCTGG - Intergenic
1164120174 19:22258821-22258843 AGTGATTTGACTCTCCTGCCTGG - Intergenic
1164126779 19:22325625-22325647 GGTGATGTGACTCTCCTGCCTGG + Intergenic
1164126995 19:22327535-22327557 AGTGATGTGAGTCTCCTGCCTGG + Intergenic
1164127675 19:22333431-22333453 AGTGATGTGACTCTTCTGCCTGG - Intergenic
1164127683 19:22333499-22333521 AATGTCATGAATCTCTTGTCTGG - Intergenic
1164127821 19:22334507-22334529 AGTGATTTGAGTCTCATGCCTGG - Intergenic
1164128180 19:22337434-22337456 GGTGATGTTACTCTCTTGCCTGG - Intergenic
1164128300 19:22338368-22338390 AGTGATTTGACTCTACTGCCTGG - Intergenic
1164128452 19:22339812-22339834 AACGATGTGACTCTCCAGCCTGG - Intergenic
1164128521 19:22340387-22340409 AGTGATTTGACTCTCTTGCCTGG - Intergenic
1164128713 19:22342339-22342361 AGTGATTTGACTCTCCTGCCTGG + Intergenic
1164129243 19:22346829-22346851 GGCGATGTGACTCTCTTGCCTGG + Intergenic
1164129830 19:22351366-22351388 AGTAATGTGACTTTCTTGCCAGG + Intergenic
1164169718 19:22714643-22714665 AGTAATGTGACTTTCTTGCCAGG - Intergenic
1164170756 19:22722998-22723020 AGTGATTTGACTCTCCTGCCTGG - Intergenic
1164171004 19:22725257-22725279 AGTGATTTGACTCTCTTGCCTGG + Intergenic
1164171078 19:22725837-22725859 AATGATGTGACTCTCCAGCCTGG + Intergenic
1164171181 19:22726958-22726980 AGTGATTTGACTCTACTGCCTGG + Intergenic
1164171299 19:22727891-22727913 GGTGATGTTACTCTCTTGCCTGG + Intergenic
1164171825 19:22731964-22731986 AGTGATGTGACTCTCCTGCCTGG + Intergenic
1164172563 19:22738179-22738201 GGTGATGTGACTCTCCTGCCTGG - Intergenic
1164179958 19:22809631-22809653 AGTGATTTGACTCTCTTGTGAGG + Intergenic
1164180385 19:22813300-22813322 AGTGATTTGACTCTCCTGCCTGG + Intergenic
1164181300 19:22821261-22821283 AGTGATTTGACTATCCTGCCTGG + Intergenic
1164181866 19:22826179-22826201 GGTGATGTGACTCTCTTGCCTGG + Intergenic
1164191776 19:22924563-22924585 AATGTTGTGACTCTCCTGCCTGG + Intergenic
1164191783 19:22924634-22924656 AATGATGTTACTCTCCTGCCTGG + Intergenic
1164201011 19:23018586-23018608 AGTGATGTGAGTCTCTTGCCTGG - Intergenic
1164201635 19:23023998-23024020 AATGATGTGACTCTCCTGCCTGG - Intergenic
1164204366 19:23045553-23045575 AGTGATTTGACTCACCTGCCTGG - Intergenic
1164204526 19:23047178-23047200 GGTGATTTGACTCTCCTGCCTGG - Intergenic
1164204596 19:23047685-23047707 GGTGATGTGACTCTCTTGCATGG - Intergenic
1164204796 19:23049129-23049151 AGTGATTTGACTCTCCTGCCTGG - Intergenic
1164204954 19:23050587-23050609 GGTGATATGACTCTCCTGCTTGG - Intergenic
1164206161 19:23060513-23060535 AGTGATGTGACTCTCCTGCCTGG - Intergenic
1164206575 19:23064033-23064055 AGTAATCTGACTCTCTTCCCTGG - Intergenic
1164206862 19:23066274-23066296 AGTGATTTGACTCTTCTGCCTGG - Intergenic
1164207018 19:23067592-23067614 GGTGATGTGACTCTCTTGCATGG - Intergenic
1164211335 19:23100166-23100188 AGTGATGTGACTCTCCTTCCTGG + Intronic
1164233528 19:23312160-23312182 CGTGATATGACTCTCCTGCCTGG + Intronic
1164233866 19:23315264-23315286 GGTGATGTGACTCTCTTGCATGG + Intronic
1164234239 19:23318256-23318278 GATGATATAACTCTCCTGCCTGG + Intronic
1164234273 19:23318545-23318567 GATGATGTGAGTCTCTTGCCTGG + Intronic
1164234559 19:23321175-23321197 CCTGATTTGACTCTCCTGCCTGG + Intronic
1164242858 19:23405307-23405329 AGTAATTTGACTCTCCTGCCTGG - Intergenic
1164242993 19:23406696-23406718 GGTGATGTGACTCTCTTGCATGG - Intergenic
1164243117 19:23407653-23407675 TGTGATATGAGTCTCCTGCCTGG - Intergenic
1164249062 19:23461072-23461094 CATGATATGAGTCTCTTGCTTGG + Intergenic
1164249334 19:23463576-23463598 CCTGATTTGACTCTCCTGCCTGG + Intergenic
1164255497 19:23524645-23524667 AGTGATTTGACTCTCCTGCCTGG - Intergenic
1164257687 19:23543559-23543581 TGTGATATGACTCTCCTGTCTGG - Intronic
1164257955 19:23545647-23545669 AATGGTTTGACTCTCTTCCCTGG - Intronic
1164281188 19:23770147-23770169 GATGATGTGACTCTCTTGCATGG + Intronic
1164281337 19:23771547-23771569 AGTGATTTGACTCTCCTGCCTGG + Intronic
1164283440 19:23789368-23789390 TGTGATATGACTCTCCTGTCTGG + Intronic
1164293675 19:23889907-23889929 TGTGATGTGACTCTCCTGCCTGG + Intergenic
1164295535 19:23906529-23906551 AGTGATTTGACACTCCTGCCTGG + Intergenic
1164302953 19:23978009-23978031 GATGATGTGAGTCTCTTGCCTGG - Intergenic
1164303309 19:23981048-23981070 GGTGATGTGACTCTCTTGCATGG - Intergenic
1164303642 19:23984215-23984237 CATGATGTGACTCTCTTGCCTGG - Intergenic
1164303972 19:23987352-23987374 GGTGATGTGACTCTCTTGCATGG - Intergenic
1164311488 19:24050059-24050081 TGTGATATGAGTCTCCTGCCTGG + Intronic
1164311742 19:24051968-24051990 GATGATGTGACTCTCTTGGATGG + Intronic
1164311754 19:24052039-24052061 GGTGATGTGACTCTCTTGCATGG + Intronic
1164311900 19:24053421-24053443 AGTAATTTGACTCTCCTGCCTGG + Intronic
1164312765 19:24060587-24060609 GATGTTATGACTCTCCCGCCTGG + Intronic
1164312777 19:24060726-24060748 GATGATATGACTCTCCTTCCTGG + Intronic
1164313740 19:24068661-24068683 TGTGATATGACTCTCCTGTCTGG + Intronic
1164324959 19:24183018-24183040 CCTGATTTGACTCTCCTGCCTGG - Intergenic
1164325239 19:24185538-24185560 GATGATGTGAGTCTCTTGTCTGG - Intergenic
1164325616 19:24188794-24188816 GATGTTATGACTCTCTTGAATGG - Intergenic
1164325952 19:24191931-24191953 CATGGTGTGACTCTCTTTCCTGG - Intergenic
1164417905 19:28061496-28061518 AAAAATATGACTATCTTGGCTGG + Intergenic
925090058 2:1148145-1148167 ACTGATCTGACCCTCTTGCAGGG - Intronic
932841806 2:75090106-75090128 AATGACATGACCATCTTGCTGGG + Intronic
932868052 2:75367655-75367677 AATGATGTTACTCTCCTCCCTGG + Intergenic
935530254 2:104223294-104223316 AATGATATGACTCAGTTTGCTGG - Intergenic
937108752 2:119345507-119345529 ATTGATATGATTCTCTTCTCAGG - Intronic
938187350 2:129243280-129243302 GGTGATGTGAGTCTCTTGCCTGG - Intergenic
938687894 2:133758765-133758787 AAGGACATGACTCTATTCCCTGG - Intergenic
940939530 2:159542610-159542632 CAGGATCTTACTCTCTTGCCTGG - Intronic
942564796 2:177255582-177255604 CATGATCTTACTCTGTTGCCTGG + Intronic
942609406 2:177727295-177727317 CTGGATATGACTCTCTTGGCTGG - Intronic
946084799 2:217159837-217159859 AATGATATGAGTCTAGGGCCGGG - Intergenic
947083153 2:226421082-226421104 AATGACATGTCTCATTTGCCAGG - Intergenic
947939010 2:234032585-234032607 TATAATATGACTCTCTTGGGAGG - Intergenic
1169500640 20:6157627-6157649 GAAGAGATGACTCCCTTGCCAGG + Intergenic
1170101202 20:12701244-12701266 AATGATATGGCTCTGTTGCCTGG - Intergenic
1176956240 21:15107433-15107455 AATGAACTGACTGTCTTGCATGG + Intergenic
1178248995 21:30983961-30983983 AATTACATGATTATCTTGCCAGG - Intergenic
1182004138 22:26944958-26944980 AATGACATGCCTCTCTGGACAGG + Intergenic
950346640 3:12301055-12301077 AATGATATGAAACTAATGCCAGG + Intronic
953174327 3:40535703-40535725 CATACTATGACTCTCTTCCCAGG - Exonic
953400684 3:42612802-42612824 AACGATATGATTCTACTGCCTGG + Intronic
957038720 3:75319330-75319352 AATGATAGGACAGTCTTTCCAGG - Intergenic
957350094 3:79013417-79013439 AAAGAACTGACTGTCTTGCCTGG + Intronic
958993917 3:100879280-100879302 AATAATGTGGCTCTCTTGCCTGG - Intronic
959109732 3:102107890-102107912 AATAATCTGACTCTCTTGTTAGG - Intronic
961028393 3:123581186-123581208 AATGTTATGATGGTCTTGCCTGG + Intronic
961086755 3:124074629-124074651 AATGATAGGACAGTCTTTCCAGG - Intergenic
966120617 3:176515123-176515145 AATGATATGGGTCTGTTGTCTGG + Intergenic
968161379 3:196430412-196430434 AATGATCTTGCTCTGTTGCCAGG + Intronic
985613594 5:905575-905597 AATGCTCTAACTTTCTTGCCGGG - Intronic
986998849 5:13638278-13638300 AAAGATATGACTCTCTTAAGAGG - Intergenic
987803048 5:22722527-22722549 AATGATATAAATCTCATGTCAGG + Intronic
991289378 5:65017650-65017672 GGTGTTATGACTCTCTTTCCTGG - Intronic
991920968 5:71656536-71656558 AATGATATGACCTTCATCCCAGG - Intronic
994417358 5:99489295-99489317 AATGTGTTGACTCTCTTGCCTGG + Intergenic
994462604 5:100085871-100085893 AATGTGTTGACTCTCTTGCCTGG - Intergenic
1002890552 6:1327860-1327882 AATGGTATGATACACTTGCCTGG + Intergenic
1003953064 6:11136246-11136268 TGTAAAATGACTCTCTTGCCAGG + Exonic
1004881513 6:20013115-20013137 AGTGATTTGCCTCTCTTGCTGGG - Intergenic
1005784135 6:29225257-29225279 AATGATATGGCTATTTTTCCTGG - Intergenic
1006908841 6:37550810-37550832 AATAATAGGACTCACTTCCCAGG + Intergenic
1008040835 6:46796545-46796567 AAGGAGATGACTCTCTTGATTGG - Intronic
1009264751 6:61539179-61539201 AATGATTTAAATCTCTTGCCTGG + Intergenic
1009950087 6:70385530-70385552 GATGGTATCACTCTCTTTCCTGG - Intergenic
1011001527 6:82593427-82593449 AATGATATGAATCTCTGGTTAGG + Intergenic
1012117478 6:95321255-95321277 AATGGTATGACTCACTTTCCTGG - Intergenic
1012865040 6:104608971-104608993 AATCATATGTCTGCCTTGCCAGG + Intergenic
1014076652 6:117243389-117243411 AATGAGATGCCTTTCTTGTCTGG - Intergenic
1014197960 6:118580309-118580331 AATGATACGACTCTGATGACTGG - Intronic
1015023694 6:128507657-128507679 TATGAACTGCCTCTCTTGCCTGG - Intronic
1015346864 6:132170704-132170726 AACCTTGTGACTCTCTTGCCTGG - Intergenic
1016225387 6:141729171-141729193 AATGTTAAGACTGTCTTGTCAGG - Intergenic
1016375749 6:143419011-143419033 ATTTATATAACTCTCTTGCTAGG - Intergenic
1020426573 7:8073073-8073095 AATCATGTCACTCTCCTGCCAGG + Intronic
1022597949 7:31730694-31730716 ATTGACATGACTGTCTTCCCTGG - Intergenic
1024851023 7:53716930-53716952 ACTCATAGAACTCTCTTGCCAGG + Intergenic
1025156560 7:56612325-56612347 GGTGATGTAACTCTCTTGCCTGG - Intergenic
1025156948 7:56615501-56615523 AATAATGTGACTCTTCTGCCTGG - Intergenic
1025157154 7:56617314-56617336 GATAATGTGACTCTCCTGCCTGG - Intergenic
1025161091 7:56661468-56661490 GGTGATGTGACTCTCCTGCCTGG + Intergenic
1025161223 7:56662917-56662939 GGTGATATGACTGTCCTGCCTGG + Intergenic
1025161680 7:56666848-56666870 AATGATATAACTCTTTTTCCTGG + Intergenic
1025223859 7:57139769-57139791 AATGATATAACTCTTTTTTCTGG + Exonic
1025722057 7:64025946-64025968 AGTGATATGACTCTCATGTCTGG + Intergenic
1025722197 7:64027078-64027100 TGTGATGTGACTCTCCTGCCTGG - Intergenic
1025722338 7:64027962-64027984 GGTGATGTGACTCTCTTGTCTGG - Intergenic
1025743923 7:64226390-64226412 AGTGATGTGACTCTTCTGCCAGG - Intronic
1025744364 7:64230024-64230046 AATGATGTTACCCTCCTGCCTGG - Intronic
1025745804 7:64241649-64241671 AATGATATAACTCTTTATCCTGG - Intronic
1025750115 7:64286617-64286639 GATGATGTGACTCTCCTGCCTGG - Intergenic
1025751592 7:64298562-64298584 AATGATGTGACTCTTCTGCCTGG - Intergenic
1025758638 7:64369780-64369802 AATAATATGATTCTCTTGCCTGG + Intergenic
1025758756 7:64370814-64370836 GGTGATGTGACTCTCTTGCCTGG + Intergenic
1025759033 7:64373131-64373153 ACTGATATGACTCTTCTGACTGG + Intergenic
1025759257 7:64374928-64374950 AATGACATGACTCTCTTGCCTGG + Intergenic
1025759614 7:64377762-64377784 AATGATGTGGCTCTTCTGCCTGG + Intergenic
1025760322 7:64383424-64383446 GGTGATGTAACTCTCTTGCCTGG + Intergenic
1025781573 7:64606677-64606699 GGTGATGTGACTCTCTTGCCTGG + Intergenic
1025782102 7:64611058-64611080 AGTGATTTGACTCTCCTGTCTGG + Intergenic
1025784066 7:64628140-64628162 CATGATGTGACTCTTCTGCCTGG + Intergenic
1025784405 7:64631543-64631565 GGTGATATTACTCTCCTGCCTGG + Intergenic
1025785177 7:64637377-64637399 CATGATGTGACTCTCCTGCCTGG - Intergenic
1025785227 7:64637882-64637904 AATCATGTGGCTCTTTTGCCTGG - Intergenic
1025785377 7:64639118-64639140 AGTGATTTGACTCTCTTGCCTGG + Intergenic
1025786482 7:64648613-64648635 AATGATGTGACTCTCCTGTCTGG + Intergenic
1025786796 7:64651347-64651369 GGTGATGTGACTCTCCTGCCTGG + Intergenic
1030622945 7:111811841-111811863 ATTTATATGACTCTCCTGCTTGG - Intronic
1031733304 7:125324838-125324860 AATGTAGTGACTCTATTGCCAGG - Intergenic
1036624849 8:10461423-10461445 AATGATATGACCTTTTAGCCTGG - Intergenic
1036664939 8:10731855-10731877 AATGATAAGACTGACTTTCCGGG + Intronic
1036753892 8:11460021-11460043 AATGAAATGAGTCCCTGGCCTGG - Intronic
1037022897 8:13995769-13995791 AAGGATAAGGATCTCTTGCCTGG - Intergenic
1040066743 8:43151156-43151178 AATGATAAGATACTCTTACCAGG + Intronic
1040357860 8:46637101-46637123 AATGATATGACTCTCTTGCCTGG + Intergenic
1040357930 8:46637818-46637840 GGTGATGTGACTCTCCTGCCTGG + Intergenic
1040358506 8:46642642-46642664 AGTGATGTGACTCTTCTGCCTGG + Intergenic
1040358573 8:46643139-46643161 GGTGATGTAACTCTCTTGCCTGG + Intergenic
1040358931 8:46646351-46646373 AATAATGTGACTCTTCTGCCTGG + Intergenic
1040359266 8:46649718-46649740 AATGATATGACTCTCTTGCCTGG + Intergenic
1040359421 8:46651097-46651119 GATGATATTACTCTTCTGCCCGG + Intergenic
1040371329 8:46778760-46778782 AATGATATGACTTTCATGCCTGG + Intergenic
1040371393 8:46779482-46779504 GGTGATGTGACTCTCCTGCCTGG + Intergenic
1040374785 8:46814597-46814619 GATGATGTGATTCTCCTGCCTGG + Intergenic
1040375189 8:46817962-46817984 AAAGATATGACTCTCTTGCCTGG + Intergenic
1040375250 8:46818688-46818710 GGTGATGTGACTCTCCTGCCTGG + Intergenic
1040375712 8:46822823-46822845 ATTGACATGACTCTCTTGCCTGG + Intergenic
1040375861 8:46824056-46824078 GGTGACATAACTCTCTTGCCTGG + Intergenic
1040376030 8:46825533-46825555 GATGATGTGACTCTTCTGCCTGG + Intergenic
1040377355 8:46839306-46839328 AATAATGTGACTCTTCTGCCTGG + Intergenic
1040377579 8:46841407-46841429 AATGATATAACTGTGTTGCCTGG + Intergenic
1040377723 8:46842633-46842655 GGTGATGTAACTCTCTTGCCTGG + Intergenic
1040378168 8:46846477-46846499 AATGATAAGACTCTCTTGCCTGG + Intergenic
1040378225 8:46847188-46847210 GGTGATGTGACTCTCCTGCCTGG + Intergenic
1040378514 8:46849806-46849828 AATGATATGACTGTCTTGCCTGG + Intergenic
1040378586 8:46850526-46850548 GGTGATGTGACTCTCCTGCCTGG + Intergenic
1040379113 8:46855125-46855147 AATGACATGAGTTTCTTGCCTGG + Intergenic
1040379566 8:46859194-46859216 AATAATGTGACTCTTCTGCCTGG + Intergenic
1040379792 8:46861341-46861363 AATGATATGACTCTCTTGCCTGG + Intergenic
1040379913 8:46862547-46862569 GGTGATGTAACTCTCTTGCCTGG + Intergenic
1040381324 8:46876169-46876191 GGTGATGTTACTCTCTTGCCTGG - Intergenic
1040381918 8:46881407-46881429 AGTGATGTGACTCTTCTGCCTGG - Intergenic
1040382006 8:46882129-46882151 AATGACATGACCCTCTTGCCTGG - Intergenic
1040382244 8:46884206-46884228 AATAATGTGACTCTTCTGCCTGG - Intergenic
1040382713 8:46888303-46888325 AATGACATGACTCTCTTGCCTGG - Intergenic
1040382851 8:46889665-46889687 AGTGATATGACTCTTCTGACTGG - Intergenic
1040383092 8:46891993-46892015 GGTGATGTGACTCTCCTGCCTGG - Intergenic
1040396322 8:47003794-47003816 TTTGATTTGACTCTCTTACCTGG - Intergenic
1045170441 8:99661488-99661510 AATTTTATGACTTTCTTACCTGG - Exonic
1052033821 9:23657820-23657842 ACGGATATGACTCCCTGGCCAGG + Intergenic
1052530205 9:29673528-29673550 AAAGAAATGAGTCCCTTGCCCGG + Intergenic
1058208881 9:102142507-102142529 AGTGATATGCCTCTTTTTCCAGG - Intergenic
1187262074 X:17694644-17694666 ACTGAAATGACTAACTTGCCAGG - Intronic
1190982149 X:55465688-55465710 AATGATATGACTATATACCCAGG - Intergenic
1190986549 X:55507494-55507516 AATGATATGACTATATACCCAGG + Intergenic
1195114577 X:101683948-101683970 AATGAAGTAACTCTGTTGCCAGG + Intergenic
1196596800 X:117555153-117555175 AATGCTCTGACTCTCTTTTCTGG - Intergenic
1197721549 X:129748087-129748109 CATGATATGATTTGCTTGCCTGG + Intronic
1200006572 X:153089169-153089191 AATGAAATGACTTTCTTCTCAGG + Intergenic
1200843231 Y:7805076-7805098 AATGATGTGACTCTCTTACCTGG - Intergenic
1200843747 Y:7810431-7810453 AAAGATATGACTCTTCTGACTGG - Intergenic
1200844294 Y:7815444-7815466 GGTGATGTGACTCTCATGCCTGG - Intergenic
1200844354 Y:7816156-7816178 TATGATATGACTCTCTTGCCTGG - Intergenic
1200844691 Y:7819693-7819715 GATGATATGGCTCTCCTGCCTGG - Intergenic
1200844840 Y:7821417-7821439 GGTGATGTAACTCTCTTGCCTGG - Intergenic
1200848752 Y:7860386-7860408 AATGATACGACTCTCTTGCCTGG - Intergenic
1200848843 Y:7861429-7861451 AATGATATGACTCTTTTTCTAGG - Intergenic
1200849785 Y:7871169-7871191 AATGTTATGACACTCTTGCCTGG - Intergenic
1200850239 Y:7875686-7875708 GGTGACATAACTCTCTTGCCTGG - Intergenic
1200850697 Y:7880284-7880306 AATGATATGATTTTCTTGCCTGG - Intergenic
1200853951 Y:7917246-7917268 AATAACATGACTCTTTTGCCTGG - Intergenic
1200854217 Y:7919927-7919949 AATTATATGACTCTCTTTCCTGG - Intergenic
1200855344 Y:7931992-7932014 AATGATATGACCCTCTTGCCTGG - Intergenic
1200856259 Y:7941554-7941576 GGTGATGTGACTCTCCTGCCTGG - Intergenic
1200856311 Y:7942275-7942297 AATGATATGACTCTCTTGCCTGG - Intergenic
1200858387 Y:7963651-7963673 GGTGATATGACTCTCCTGCCTGG - Intergenic
1200858490 Y:7964863-7964885 AACAATATGACTCTCTTGCCTGG - Intergenic
1200858907 Y:7968957-7968979 AGTGATATTACTCTCCTGTCTGG - Intergenic
1200859009 Y:7970168-7970190 GATGATATGGCTCTTCTGCCAGG - Intergenic
1200859471 Y:7974997-7975019 GGTGATGTAACTCTCTTGCCTGG - Intergenic
1200859587 Y:7976224-7976246 AATGATATGACTCTTTTCTGGGG - Intergenic
1200859958 Y:7980190-7980212 GGTGGTATGACTCTCCTGCCTGG - Intergenic
1200862344 Y:8006376-8006398 AATGATATGAATTTCTTGTTTGG - Intergenic
1200862768 Y:8010414-8010436 AATGATAAGACATTCTTCCCTGG - Intergenic
1200863374 Y:8016489-8016511 AGTGATATGACTCTTCTTCCTGG - Intergenic
1200863555 Y:8018464-8018486 AATGACATGATTCTGTTGCATGG - Intergenic
1200864010 Y:8023295-8023317 AATGTCATGACTCTCTTGCCTGG - Intergenic
1200865327 Y:8037562-8037584 GGTGATATGACTCTCCTGCCTGG + Intergenic
1200865823 Y:8042159-8042181 AGTGGTCTGACTCTCTTGCCTGG + Intergenic
1200867737 Y:8063154-8063176 AATAATGTGACTCTTCTGCCTGG + Intergenic
1200867929 Y:8065326-8065348 AATGGTATGACTTTCTTGCCTGG + Intergenic
1200868598 Y:8073304-8073326 AATAATGTGACTCTGCTGCCTGG - Intergenic
1200870463 Y:8092582-8092604 CATGATGGGACTCTCCTGCCTGG - Intergenic
1200870522 Y:8093299-8093321 AATTATATGACTCTCTTGCCTGG - Intergenic
1200890067 Y:8313776-8313798 AATTATATGAATCTCTTGCCTGG + Intergenic
1200891423 Y:8328527-8328549 GGTGATGTGACTCTCCTGCCTGG + Intergenic
1200891706 Y:8330982-8331004 AATGATGTGACTCTTTTGCCTGG + Intergenic
1200892301 Y:8336961-8336983 AATGATATGACTCTTCTGCCTGG + Intergenic
1200892572 Y:8339580-8339602 GATGATATTACTCTTTTGCTTGG + Intergenic
1200893994 Y:8355036-8355058 GGTGATGTGACTCTCCTGCCTGG - Intergenic
1200894054 Y:8355756-8355778 AATGATATGACTTTCTTGCCTGG - Intergenic
1200894542 Y:8360848-8360870 AATGATGTGACTCTTCTGCCTGG - Intergenic
1200894769 Y:8363408-8363430 AATAATATGACTCTTCTGCCTGG - Intergenic
1200895820 Y:8375065-8375087 GGTGATATGACTCTTCTGCCTGG - Intergenic
1200895878 Y:8375684-8375706 GGTGATATGACTCTCCTGCCTGG - Intergenic
1200895892 Y:8375755-8375777 AATTACATGAGTCTCTTCCCCGG - Intergenic
1200896282 Y:8379303-8379325 ATTCATATGACTTTCTTGCCGGG - Intergenic
1200896683 Y:8383248-8383270 GGTGATGTGACTCTCCTGCCTGG - Intergenic
1200896755 Y:8383969-8383991 AATGATATGAAATTTTTGCCTGG - Intergenic
1200897477 Y:8390966-8390988 AAAGACATGAATCTCTTGCCTGG - Intergenic
1200897910 Y:8395435-8395457 GGTGATGTGACTCTCCTGCCTGG - Intergenic
1200900882 Y:8430742-8430764 AATGTCATGACTCTCTGACCTGG - Intergenic
1200901218 Y:8434070-8434092 AGTGATCTGAATCTCTTGCCTGG - Intergenic
1200901675 Y:8438896-8438918 AATGACATGACACTCTTTTCTGG - Intergenic
1200901823 Y:8440328-8440350 AATGATGTGGCTCTTCTGCCTGG - Intergenic
1200904827 Y:8471213-8471235 AATGATATGAATTTCTTACTTGG + Intergenic
1200904893 Y:8471922-8471944 GGTGATATGACTCTCCTGCCTGG + Intergenic
1200905143 Y:8474111-8474133 AATAACATGCCTCTCCTGCCTGG + Intergenic
1200906890 Y:8492846-8492868 AATGATATGACCCTTGTGCCTGG + Intergenic
1202245829 Y:22819118-22819140 AATAATATGACTCTTCTGCCTGG + Intergenic
1202245987 Y:22820782-22820804 AGTGATGTGACTCTTCTGCCAGG + Intergenic
1202246031 Y:22821253-22821275 AATGACATGATTCTCTTTCGTGG + Intergenic
1202246096 Y:22821973-22821995 GTTGATGTGACTCTCCTGCCTGG + Intergenic
1202246377 Y:22824415-22824437 AATAATGTGACTCTTTTGCCCGG + Intergenic
1202246460 Y:22825305-22825327 GGTGATGTGACTCTCCTGCCTGG + Intergenic
1202251683 Y:22879712-22879734 AATGACATGACTCTCTGGCCTGG - Intergenic
1202252157 Y:22884534-22884556 AGTGATCTGACTCTTTTGCCTGG - Intergenic
1202252819 Y:22890606-22890628 GGTGATATGACTCTCCTACCTGG - Intergenic
1202254190 Y:22903958-22903980 AATGATATGACTCGTTTTTCTGG - Intergenic
1202254553 Y:22907481-22907503 AATGACATGACTCTCCTGACTGG + Intergenic
1202255294 Y:22914391-22914413 GGTGATATAACTCTCTTGTCTGG + Intergenic
1202255403 Y:22915391-22915413 AATGATATGAATTTCTTGCTTGG + Intergenic
1202259673 Y:22957393-22957415 AATGATATGACCCTTTTTCCTGG + Intergenic
1202260719 Y:22967477-22967499 AATGATATGACTCTCTTGCCTGG + Intergenic
1202260814 Y:22968531-22968553 GGTGATGTGACTCTCCTGCCTGG + Intergenic
1202261242 Y:22972640-22972662 AATGACATGACTCTCTTGCCTGG + Intergenic
1202262311 Y:22982669-22982691 AATGACATGACCCTCTTGCCTGG + Intronic
1202263026 Y:22989606-22989628 AATGATATGACTCTCTTGCCTGG + Intronic
1202263337 Y:22992670-22992692 AATGACATGAGTCTCTTGTCTGG + Intronic
1202263414 Y:22993387-22993409 AGTGACGTGACTCTTTTGCCTGG + Intronic
1202263474 Y:22993880-22993902 GGTGACATAACTCTCTTGCCTGG + Intronic
1202264024 Y:22999269-22999291 AATGATATGACACTCTTGCCTGG + Intronic
1202264797 Y:23006816-23006838 AATGATATGACTCCATTTCCTGG + Intergenic
1202265289 Y:23011710-23011732 AATGATACGACTCTCTTTCCTGG + Intergenic
1202268112 Y:23042262-23042284 AATGATTTGACTCTTTTTCTAGG + Intergenic
1202268215 Y:23043299-23043321 AATGATATAAATCTCTTGCCTGG + Intergenic
1202398817 Y:24452866-24452888 AATAATATGACTCTTCTGCCTGG + Intergenic
1202398975 Y:24454530-24454552 AGTGATGTGACTCTTCTGCCAGG + Intergenic
1202399019 Y:24455001-24455023 AATGACATGATTCTCTTTCGTGG + Intergenic
1202399084 Y:24455721-24455743 GTTGATGTGACTCTCCTGCCTGG + Intergenic
1202399365 Y:24458163-24458185 AATAATGTGACTCTTTTGCCCGG + Intergenic
1202399448 Y:24459053-24459075 GGTGATGTGACTCTCCTGCCTGG + Intergenic
1202404671 Y:24513461-24513483 AATGACATGACTCTCTGGCCTGG - Intergenic
1202405145 Y:24518283-24518305 AGTGATCTGACTCTTTTGTCTGG - Intergenic
1202405808 Y:24524355-24524377 GGTGATATGACTCTCCTACCTGG - Intergenic
1202407180 Y:24537707-24537729 AATGATATGACTCGTTTTTCTGG - Intergenic
1202407544 Y:24541230-24541252 AATGACATGACTCTCCTGACTGG + Intergenic
1202408285 Y:24548140-24548162 GGTGATATAACTCTCTTGTCTGG + Intergenic
1202408394 Y:24549140-24549162 AATGATATGAATTTCTTGCTTGG + Intergenic
1202412659 Y:24591137-24591159 AATGATATGACCCTTTTTCCTGG + Intergenic
1202413706 Y:24601218-24601240 AATGATATGACTCTCTTGCCTGG + Intergenic
1202413802 Y:24602272-24602294 GGTGATGTGACTCTCCTGCCTGG + Intergenic
1202414230 Y:24606381-24606403 AATGACATGACTCTCTTGCCTGG + Intergenic
1202415301 Y:24616410-24616432 AATGACATGACCCTCTTGCCTGG + Intronic
1202416016 Y:24623347-24623369 AATGATATGACTCTCTTGCCTGG + Intronic
1202416327 Y:24626411-24626433 AATGACATGAGTCTCTTGTCTGG + Intronic
1202416404 Y:24627128-24627150 AGTGACGTGACTCTTTTGCCTGG + Intronic
1202416464 Y:24627621-24627643 GGTGACATAACTCTCTTGCCTGG + Intronic
1202417015 Y:24633011-24633033 AATGATATGACACTCTTGCCTGG + Intronic
1202417788 Y:24640558-24640580 AATGATATGACTCCATTTCCTGG + Intergenic
1202418282 Y:24645452-24645474 AATGATACGACTCTCTTTCCTGG + Intergenic
1202421104 Y:24676006-24676028 AATGATTTGACTCTTTTTCTAGG + Intergenic
1202421207 Y:24677043-24677065 AATGATATAAATCTCTTGCCTGG + Intergenic
1202449579 Y:24993039-24993061 AATGATATAAATCTCTTGCCTGG - Intergenic
1202449682 Y:24994076-24994098 AATGATTTGACTCTTTTTCTAGG - Intergenic
1202452504 Y:25024634-25024656 AATGATACGACTCTCTTTCCTGG - Intergenic
1202452998 Y:25029528-25029550 AATGATATGACTCCATTTCCTGG - Intergenic
1202453772 Y:25037075-25037097 AATGATATGACACTCTTGCCTGG - Intronic
1202454323 Y:25042465-25042487 GGTGACATAACTCTCTTGCCTGG - Intronic
1202454383 Y:25042958-25042980 AGTGACGTGACTCTTTTGCCTGG - Intronic
1202454460 Y:25043675-25043697 AATGACATGAGTCTCTTGTCTGG - Intronic
1202454771 Y:25046739-25046761 AATGATATGACTCTCTTGCCTGG - Intronic
1202455486 Y:25053676-25053698 AATGACATGACCCTCTTGCCTGG - Intronic
1202456555 Y:25063705-25063727 AATGACATGACTCTCTTGCCTGG - Intergenic
1202456983 Y:25067814-25067836 GGTGATGTGACTCTCCTGCCTGG - Intergenic
1202457079 Y:25068868-25068890 AATGATATGACTCTCTTGCCTGG - Intergenic
1202458121 Y:25078933-25078955 AATGATATGACCCTTTTTCCTGG - Intergenic
1202462388 Y:25120940-25120962 AATGATATGAATTTCTTGCTTGG - Intergenic
1202462497 Y:25121940-25121962 GGTGATATAACTCTCTTGTCTGG - Intergenic
1202463238 Y:25128851-25128873 AATGACATGACTCTCCTGACTGG - Intergenic
1202463601 Y:25132374-25132396 AATGATATGACTCGTTTTTCTGG + Intergenic
1202464972 Y:25145727-25145749 GGTGATATGACTCTCCTACCTGG + Intergenic
1202465634 Y:25151799-25151821 AGTGATCTGACTCTTTTGTCTGG + Intergenic
1202466108 Y:25156621-25156643 AATGACATGACTCTCTGGCCTGG + Intergenic
1202471332 Y:25211033-25211055 GGTGATGTGACTCTCCTGCCTGG - Intergenic
1202471415 Y:25211923-25211945 AATAATGTGACTCTTTTGCCCGG - Intergenic
1202471696 Y:25214365-25214387 GTTGATGTGACTCTCCTGCCTGG - Intergenic
1202471761 Y:25215085-25215107 AATGACATGATTCTCTTTCGTGG - Intergenic
1202471805 Y:25215556-25215578 AGTGATGTGACTCTTCTGCCAGG - Intergenic
1202471963 Y:25217220-25217242 AATAATATGACTCTTCTGCCTGG - Intergenic