ID: 1202270222

View in Genome Browser
Species Human (GRCh38)
Location Y:23065064-23065086
Sequence CCGTGGTGGCATGCACCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202270222_1202270226 -8 Left 1202270222 Y:23065064-23065086 CCTGCAGGTGCATGCCACCACGG No data
Right 1202270226 Y:23065079-23065101 CACCACGGTCAGCAAGATTTGGG No data
1202270222_1202270231 11 Left 1202270222 Y:23065064-23065086 CCTGCAGGTGCATGCCACCACGG No data
Right 1202270231 Y:23065098-23065120 TGGGGGTTTTTGTAGAGACAGGG No data
1202270222_1202270229 -6 Left 1202270222 Y:23065064-23065086 CCTGCAGGTGCATGCCACCACGG No data
Right 1202270229 Y:23065081-23065103 CCACGGTCAGCAAGATTTGGGGG No data
1202270222_1202270227 -7 Left 1202270222 Y:23065064-23065086 CCTGCAGGTGCATGCCACCACGG No data
Right 1202270227 Y:23065080-23065102 ACCACGGTCAGCAAGATTTGGGG No data
1202270222_1202270225 -9 Left 1202270222 Y:23065064-23065086 CCTGCAGGTGCATGCCACCACGG No data
Right 1202270225 Y:23065078-23065100 CCACCACGGTCAGCAAGATTTGG No data
1202270222_1202270230 10 Left 1202270222 Y:23065064-23065086 CCTGCAGGTGCATGCCACCACGG No data
Right 1202270230 Y:23065097-23065119 TTGGGGGTTTTTGTAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202270222 Original CRISPR CCGTGGTGGCATGCACCTGC AGG (reversed) Intergenic
No off target data available for this crispr