ID: 1202271008

View in Genome Browser
Species Human (GRCh38)
Location Y:23073886-23073908
Sequence GGGCGAAGGATGCTGAGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202271002_1202271008 0 Left 1202271002 Y:23073863-23073885 CCAGGATGCTGGCACCAGAAAAA No data
Right 1202271008 Y:23073886-23073908 GGGCGAAGGATGCTGAGCATGGG No data
1202270999_1202271008 13 Left 1202270999 Y:23073850-23073872 CCCTCAAAGAAAGCCAGGATGCT No data
Right 1202271008 Y:23073886-23073908 GGGCGAAGGATGCTGAGCATGGG No data
1202271000_1202271008 12 Left 1202271000 Y:23073851-23073873 CCTCAAAGAAAGCCAGGATGCTG No data
Right 1202271008 Y:23073886-23073908 GGGCGAAGGATGCTGAGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202271008 Original CRISPR GGGCGAAGGATGCTGAGCAT GGG Intergenic
No off target data available for this crispr