ID: 1202272692

View in Genome Browser
Species Human (GRCh38)
Location Y:23086092-23086114
Sequence TCAAGCGGGCCCGCAAGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202272684_1202272692 -5 Left 1202272684 Y:23086074-23086096 CCCACACCCACCCGGAACTCAAG No data
Right 1202272692 Y:23086092-23086114 TCAAGCGGGCCCGCAAGCGCCGG No data
1202272680_1202272692 15 Left 1202272680 Y:23086054-23086076 CCGAGTGCGGGCCTGCCAAGCCC No data
Right 1202272692 Y:23086092-23086114 TCAAGCGGGCCCGCAAGCGCCGG No data
1202272681_1202272692 4 Left 1202272681 Y:23086065-23086087 CCTGCCAAGCCCACACCCACCCG 0: 26
1: 421
2: 518
3: 423
4: 706
Right 1202272692 Y:23086092-23086114 TCAAGCGGGCCCGCAAGCGCCGG No data
1202272685_1202272692 -6 Left 1202272685 Y:23086075-23086097 CCACACCCACCCGGAACTCAAGC No data
Right 1202272692 Y:23086092-23086114 TCAAGCGGGCCCGCAAGCGCCGG No data
1202272683_1202272692 0 Left 1202272683 Y:23086069-23086091 CCAAGCCCACACCCACCCGGAAC 0: 63
1: 709
2: 625
3: 344
4: 428
Right 1202272692 Y:23086092-23086114 TCAAGCGGGCCCGCAAGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202272692 Original CRISPR TCAAGCGGGCCCGCAAGCGC CGG Intergenic
No off target data available for this crispr