ID: 1202275843

View in Genome Browser
Species Human (GRCh38)
Location Y:23118879-23118901
Sequence CAGTTTAGCCTCAGGGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202275843_1202275853 19 Left 1202275843 Y:23118879-23118901 CCTTCATCCCTGAGGCTAAACTG No data
Right 1202275853 Y:23118921-23118943 CTAGTGACTGAACATCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202275843 Original CRISPR CAGTTTAGCCTCAGGGATGA AGG (reversed) Intergenic
No off target data available for this crispr