HTGT WGE

Individual CRISPR Summary

ID: 1202275853

 View in Genome Browser
Species Human (GRCh38)
Location Y:23118921-23118943
Sequence CTAGTGACTGAACATCCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202275842_1202275853 20 Left 1202275842 Y:23118878-23118900 CCCTTCATCCCTGAGGCTAAACT No data
Right 1202275853 Y:23118921-23118943 CTAGTGACTGAACATCCCCAAGG No data
1202275847_1202275853 -7 Left 1202275847 Y:23118905-23118927 CCAAAACACCCCCAGCCTAGTGA No data
Right 1202275853 Y:23118921-23118943 CTAGTGACTGAACATCCCCAAGG No data
1202275844_1202275853 12 Left 1202275844 Y:23118886-23118908 CCCTGAGGCTAAACTGCCACCAA No data
Right 1202275853 Y:23118921-23118943 CTAGTGACTGAACATCCCCAAGG No data
1202275841_1202275853 21 Left 1202275841 Y:23118877-23118899 CCCCTTCATCCCTGAGGCTAAAC No data
Right 1202275853 Y:23118921-23118943 CTAGTGACTGAACATCCCCAAGG No data
1202275843_1202275853 19 Left 1202275843 Y:23118879-23118901 CCTTCATCCCTGAGGCTAAACTG No data
Right 1202275853 Y:23118921-23118943 CTAGTGACTGAACATCCCCAAGG No data
1202275846_1202275853 -4 Left 1202275846 Y:23118902-23118924 CCACCAAAACACCCCCAGCCTAG No data
Right 1202275853 Y:23118921-23118943 CTAGTGACTGAACATCCCCAAGG No data
1202275845_1202275853 11 Left 1202275845 Y:23118887-23118909 CCTGAGGCTAAACTGCCACCAAA No data
Right 1202275853 Y:23118921-23118943 CTAGTGACTGAACATCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202275853 Original CRISPR CTAGTGACTGAACATCCCCA AGG Intergenic
No off target data available for this crispr