ID: 1202276534

View in Genome Browser
Species Human (GRCh38)
Location Y:23126547-23126569
Sequence GCATTTTTAACATGTGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202276534_1202276541 27 Left 1202276534 Y:23126547-23126569 CCTGGGGCACATGTTAAAAATGC No data
Right 1202276541 Y:23126597-23126619 GAATAAGAGCATCTGAGAATGGG No data
1202276534_1202276540 26 Left 1202276534 Y:23126547-23126569 CCTGGGGCACATGTTAAAAATGC No data
Right 1202276540 Y:23126596-23126618 AGAATAAGAGCATCTGAGAATGG No data
1202276534_1202276542 28 Left 1202276534 Y:23126547-23126569 CCTGGGGCACATGTTAAAAATGC No data
Right 1202276542 Y:23126598-23126620 AATAAGAGCATCTGAGAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202276534 Original CRISPR GCATTTTTAACATGTGCCCC AGG (reversed) Intergenic
No off target data available for this crispr