ID: 1202276541

View in Genome Browser
Species Human (GRCh38)
Location Y:23126597-23126619
Sequence GAATAAGAGCATCTGAGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202276538_1202276541 -8 Left 1202276538 Y:23126582-23126604 CCATCCAGAGCATTAGAATAAGA No data
Right 1202276541 Y:23126597-23126619 GAATAAGAGCATCTGAGAATGGG No data
1202276537_1202276541 -7 Left 1202276537 Y:23126581-23126603 CCCATCCAGAGCATTAGAATAAG No data
Right 1202276541 Y:23126597-23126619 GAATAAGAGCATCTGAGAATGGG No data
1202276534_1202276541 27 Left 1202276534 Y:23126547-23126569 CCTGGGGCACATGTTAAAAATGC No data
Right 1202276541 Y:23126597-23126619 GAATAAGAGCATCTGAGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202276541 Original CRISPR GAATAAGAGCATCTGAGAAT GGG Intergenic