ID: 1202282177

View in Genome Browser
Species Human (GRCh38)
Location Y:23200667-23200689
Sequence CTACTTATCTTGAATAAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202282176_1202282177 15 Left 1202282176 Y:23200629-23200651 CCTTTAAGGACACGCTCACAGTA No data
Right 1202282177 Y:23200667-23200689 CTACTTATCTTGAATAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202282177 Original CRISPR CTACTTATCTTGAATAAGAA TGG Intergenic
No off target data available for this crispr