ID: 1202283714

View in Genome Browser
Species Human (GRCh38)
Location Y:23217852-23217874
Sequence CTACTTATCTTGAATAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202283714_1202283715 15 Left 1202283714 Y:23217852-23217874 CCATTCTTATTCAAGATAAGTAG No data
Right 1202283715 Y:23217890-23217912 TACTGTGAGCGTGTCCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202283714 Original CRISPR CTACTTATCTTGAATAAGAA TGG (reversed) Intergenic
No off target data available for this crispr