ID: 1202287795

View in Genome Browser
Species Human (GRCh38)
Location Y:23270792-23270814
Sequence CTACATCCAGAAATGAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 12, 1: 0, 2: 13, 3: 46, 4: 408}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202287795 Original CRISPR CTACATCCAGAAATGAAGAA TGG (reversed) Intronic
900317202 1:2063252-2063274 CTACACCCAGAACTGAAGGCAGG - Intronic
900352933 1:2245412-2245434 CTACACCCAGAACTGAAGGCAGG - Intronic
900546131 1:3230264-3230286 CAACATCCAGGAATCTAGAACGG - Intronic
903735883 1:25529794-25529816 CTCCATCTACAAATGAAGAAAGG - Intergenic
904531275 1:31171257-31171279 CTACACCCAAGAATGAACAAGGG - Intergenic
904553517 1:31341599-31341621 CTGCATCCAGGAAGGAAGCATGG + Intronic
905366941 1:37457431-37457453 CTCCATCCAATAATGAACAAGGG + Intergenic
905773382 1:40652848-40652870 CTACATCCATGCAGGAAGAAGGG + Intronic
906092363 1:43191615-43191637 ATACAATCAGAAATGAAGGAGGG - Intronic
908546174 1:65164236-65164258 CTACACCCAGGAATGAACAAGGG + Intronic
909345378 1:74578921-74578943 CGACAAACAGAAATGAAAAAGGG + Intronic
909402826 1:75253201-75253223 CTAGAACCAGAAAGGAAGAGAGG + Intronic
909561929 1:77016788-77016810 CTACATCCACAAAAGGGGAAAGG + Intronic
910173028 1:84398653-84398675 TTTCATGCAGAAATGAAGAAGGG + Exonic
910308993 1:85801643-85801665 CTACCTACAGAAATGTAGAAAGG - Intronic
910644612 1:89500082-89500104 CTACTTGCAGAAAAGAAGGAAGG + Intergenic
910809997 1:91226353-91226375 CTACACCCAGGAATGAACAAAGG - Intergenic
910823956 1:91385727-91385749 GTACAAACAGAAATGAACAAAGG - Exonic
911465465 1:98247287-98247309 CTACACAAAGAAATGAAGATTGG - Intergenic
912790625 1:112646135-112646157 GTATATCCAGAAAGGGAGAATGG + Intronic
913029199 1:114881531-114881553 CTCCATCAAGAAAGGAAGGAAGG - Intronic
913261348 1:117000630-117000652 CTACAACCAGGAATTAACAAGGG + Intergenic
913419532 1:118649707-118649729 CTACACCCCTCAATGAAGAAAGG + Intergenic
916158245 1:161879840-161879862 CAACAGCTAGAACTGAAGAAAGG - Intronic
917491218 1:175500336-175500358 CTACATCCACACAAGAAAAATGG - Intronic
918573733 1:186029577-186029599 CTACAATCAGAAATGAAAGAGGG - Intronic
918666456 1:187156831-187156853 CTAAAATCAGAAATGAAAAAGGG - Intergenic
918667971 1:187176340-187176362 CTAAAATCAGAAATGAAGAGAGG - Intergenic
918838394 1:189500650-189500672 CTACATACAGTGATCAAGAAAGG - Intergenic
919025810 1:192168318-192168340 CTAATTCAAGAAATGAATAAAGG - Intronic
919560110 1:199107178-199107200 CAAAATCAAGCAATGAAGAAAGG + Intergenic
920824458 1:209412470-209412492 CTAAATTAAGAAATGAAGAAAGG - Intergenic
921663767 1:217841153-217841175 CAATATGCAGAAATGAAGTAAGG + Intronic
922364127 1:224847985-224848007 CTCAATTCAGATATGAAGAAAGG - Intergenic
922905185 1:229168737-229168759 CTGCACCCAGGACTGAAGAAGGG + Intergenic
923328676 1:232902544-232902566 CTACACCCAGGAATGAATAAGGG + Intergenic
923766712 1:236898843-236898865 ATATATTCAGTAATGAAGAATGG + Exonic
923791642 1:237116300-237116322 GTAAATCCTTAAATGAAGAAAGG - Intronic
923878721 1:238079325-238079347 CAAAAACCAGAAATGAAGGAAGG - Intergenic
1063127125 10:3145065-3145087 CCACATCCAGAATTGAACCAGGG + Intronic
1064443917 10:15376786-15376808 CTACCTTCAGAAATGCACAAAGG + Intergenic
1065286967 10:24195544-24195566 CTACCTCCAGAAAAGAACAGAGG + Intronic
1065641396 10:27786211-27786233 CTATATCCTGAATTGAGGAAAGG - Intergenic
1065678015 10:28198761-28198783 CTACATCTAGAAATGAGGTTGGG + Intronic
1066668287 10:37809076-37809098 CTAAAATCAGAAATGAAGACAGG - Intronic
1067097425 10:43311465-43311487 CTACATCCAGCAGAGGAGAATGG - Intergenic
1067104442 10:43356712-43356734 CCACATCCAGGAATGAACAAAGG + Intergenic
1068057749 10:52032651-52032673 CTATTTCCAGCAATGAAAAAGGG - Intronic
1068751316 10:60595767-60595789 CTGCAACCAGGAATGAACAAGGG + Intronic
1069649985 10:70039619-70039641 ATACATCTAGAAATAAATAAAGG - Intergenic
1070373837 10:75810126-75810148 GCACATTCAGAAATGATGAAGGG + Intronic
1071012982 10:80960649-80960671 GTACTTAGAGAAATGAAGAATGG + Intergenic
1071120461 10:82270952-82270974 CCTCATCCTGGAATGAAGAAGGG - Intronic
1071138099 10:82475245-82475267 CTAAATTCAGAAATGAAAGAGGG + Intronic
1071426462 10:85559152-85559174 CTTCTACCAGAAATGAATAAGGG - Intergenic
1071755044 10:88527899-88527921 GTGCATCCAGAAAATAAGAAAGG + Intronic
1074215164 10:111377088-111377110 CTGCATCTGGAAATGAAGGAAGG + Intergenic
1076484314 10:130806066-130806088 CTGCATTCAGAAAGCAAGAAGGG + Intergenic
1077401150 11:2358144-2358166 CTACAACCAAAAGAGAAGAACGG + Intergenic
1077765883 11:5160129-5160151 CTATATCCAAAAAAGTAGAAAGG - Intronic
1078409912 11:11106029-11106051 CTACACCCAGAAATGACCAAGGG - Intergenic
1079663928 11:23079972-23079994 ATTCTTCCAGAAATAAAGAATGG - Intergenic
1079900111 11:26172619-26172641 CAACATACACAAATCAAGAAAGG + Intergenic
1079909034 11:26286150-26286172 CTAAATCCTGAAATGACAAAGGG + Intergenic
1080569086 11:33540039-33540061 CTCCATGCTGAAGTGAAGAAAGG - Intergenic
1081015985 11:37881386-37881408 CTACAGCAGGAAATGAAGAGTGG - Intergenic
1081185126 11:40032914-40032936 CTATACCCAGGAATGAACAAGGG + Intergenic
1081488498 11:43549045-43549067 CTACGCCCAGGAATGAACAAGGG - Intergenic
1082065321 11:47893867-47893889 CTACATGAAGAAAGGAAGACAGG + Intergenic
1082803124 11:57428810-57428832 GTACATCCAGGACTGAAGCACGG + Intergenic
1082859833 11:57844895-57844917 CTAAAATCAGAAATGAAAAAGGG + Intergenic
1082930660 11:58601429-58601451 CTAAAACCAGAAATGAAAATGGG - Intronic
1083084407 11:60127753-60127775 CTACACCCAGAAATGACCAAGGG + Intergenic
1085466100 11:76724281-76724303 CCACAAGCAGAAAGGAAGAAGGG + Intergenic
1086302933 11:85448876-85448898 GCACAGTCAGAAATGAAGAATGG - Intronic
1086364404 11:86093542-86093564 CCACATTCTGAAATAAAGAATGG - Intergenic
1086545377 11:87961635-87961657 GTACATCCTGAAAAGAGGAATGG + Intergenic
1087399616 11:97648714-97648736 ATACATCTAGAAATGACAAAGGG - Intergenic
1087560779 11:99786736-99786758 CCAAAACCAGAAATGGAGAAAGG + Intronic
1087971906 11:104494518-104494540 CTACACCCAGGAATGAACAAGGG - Intergenic
1088211500 11:107461770-107461792 CAAAATCAAGAAATGGAGAAAGG - Intergenic
1088599002 11:111459451-111459473 CTGAATTCAGAAAGGAAGAAAGG - Intergenic
1089192557 11:116663654-116663676 CTGCATCCACAAAATAAGAATGG + Intergenic
1089648651 11:119897211-119897233 CTACATGCAGAATGGAAGGATGG + Intergenic
1089986789 11:122822044-122822066 CTACATCCAGGGATGAGCAAGGG - Intergenic
1090256004 11:125284855-125284877 AAACAGCCAGAAATCAAGAATGG - Intronic
1091333771 11:134751623-134751645 CTACATGCAGGAATGAGCAAAGG - Intergenic
1091952051 12:4601447-4601469 AAACATCTACAAATGAAGAAGGG + Intronic
1092336216 12:7636295-7636317 CTGGATCCAGAAAGGAAGAAAGG + Intergenic
1092485302 12:8897789-8897811 CTACACCCAGAGATTAAGAAGGG + Intergenic
1092663155 12:10761920-10761942 AGACATCAAGAGATGAAGAATGG - Intergenic
1093011530 12:14112078-14112100 CTACATCAAGATAGGAAAAAAGG + Intergenic
1093145789 12:15565223-15565245 CTACAGGCAGGAAGGAAGAATGG - Intronic
1093197345 12:16144790-16144812 CTACGCCCAGGAATGAACAAAGG - Intergenic
1093830796 12:23755218-23755240 TTAAAACCAGAAATGATGAAAGG - Intronic
1093854897 12:24089829-24089851 AACCATCCAGAAATGAAGAAGGG - Intergenic
1093904704 12:24676819-24676841 TTACATGGAGAAAGGAAGAAGGG + Intergenic
1095186312 12:39204361-39204383 GTACATACAGACATGAAAAAGGG + Intergenic
1095202519 12:39400730-39400752 CTAGGTCCAGAAATAGAGAAAGG + Intronic
1095739546 12:45592202-45592224 CTATGGCCAGAAAAGAAGAAGGG + Intergenic
1095906543 12:47383847-47383869 CTACAGACAGAGATGAAGAGAGG + Intergenic
1095979466 12:47963115-47963137 CTATACCCAGGAATGAACAAGGG + Intergenic
1097517952 12:60629425-60629447 CTACATCAAAAAATGAAGTATGG - Intergenic
1097566464 12:61275720-61275742 CTACATACAGAAATTAACATAGG + Intergenic
1098132625 12:67366449-67366471 CTACTCCCAGGAATGAACAAGGG - Intergenic
1099397056 12:82153530-82153552 CTACACCAAGAAAGGAAGGAAGG - Intergenic
1100262208 12:92943011-92943033 CTGCACCCAGGAATGAAGAAGGG - Intergenic
1100273606 12:93049559-93049581 CTAAAACAAGAAAAGAAGAAAGG - Intergenic
1101165211 12:102022848-102022870 ATACATTCAGAAATATAGAATGG - Intronic
1101698860 12:107152815-107152837 CTCTCTCCAGAAAGGAAGAAAGG + Intergenic
1102192272 12:110997725-110997747 CTACACCCAGGAATGAACAAGGG - Intergenic
1103215800 12:119200423-119200445 CTACACCCAGGAATGAACAAGGG + Intronic
1104148146 12:126055321-126055343 AAACATACAGAAATGCAGAATGG - Intergenic
1104149428 12:126068254-126068276 CTACAGCCACAAATGAACAGAGG - Intergenic
1104605197 12:130183029-130183051 CTAAATCCATAACTGGAGAAAGG + Intergenic
1106298947 13:28445174-28445196 CTAGATTCAGAAATGAAACAGGG + Intronic
1106822735 13:33484148-33484170 CCACATCCAGGAATGACCAAGGG - Intergenic
1107171844 13:37351972-37351994 CTACTTCAAGAAATGAAAATGGG + Intergenic
1107208960 13:37828785-37828807 GTACATACAGAAACAAAGAAGGG + Intronic
1107236430 13:38176175-38176197 CTACACCCAGGAATGAACAAAGG + Intergenic
1107922534 13:45224489-45224511 CTAGAATCAGAAAAGAAGAAGGG - Intronic
1109411882 13:61981225-61981247 CTATGCCCAGAAATGAACAAGGG - Intergenic
1109647319 13:65275363-65275385 CTCCATCCAGAAGTGAATATGGG - Intergenic
1110173418 13:72529677-72529699 TTAAATCCAGAAAGGAAAAAGGG + Intergenic
1110953928 13:81529409-81529431 GTACACCCAGGAATGAACAAAGG - Intergenic
1112435041 13:99385885-99385907 CTACATCTAGTAACAAAGAATGG + Intronic
1112541093 13:100313728-100313750 CTACACCCAGGAATGAACAGGGG + Intronic
1112718616 13:102215966-102215988 CTAGATCCAGAAATGTGAAATGG + Intronic
1113266491 13:108623539-108623561 CTACATGCTTGAATGAAGAAGGG + Intronic
1113275904 13:108729781-108729803 CTACATTCAGAATGGAGGAAGGG - Intronic
1113631465 13:111889031-111889053 CTAAAATCAGGAATGAAGAAAGG - Intergenic
1114788311 14:25626324-25626346 CAACATCCTGAAACAAAGAAAGG - Intergenic
1115380662 14:32735035-32735057 CAGCATCCAGAAATGCAAAATGG + Intronic
1115713917 14:36081477-36081499 CTACTATCAGAAATGAAAAAGGG + Intergenic
1115992748 14:39166476-39166498 CTGCATCCAGAAATGACCAAGGG - Intronic
1116370823 14:44128992-44129014 CAAAATCCATAAAGGAAGAAAGG + Intergenic
1117342070 14:54800766-54800788 CTACAACAAGCAATGGAGAAAGG + Intergenic
1117416159 14:55498344-55498366 CTTCATCCAGAAATCAAAGAAGG - Intergenic
1117444578 14:55791587-55791609 CTGCATGCAGAAATGAGAAAAGG - Intergenic
1118912001 14:70069418-70069440 ATACATTCAGAAGTGATGAAAGG - Intronic
1120263423 14:82218097-82218119 GTTTATCCAGAAAAGAAGAATGG + Intergenic
1120624236 14:86804574-86804596 CTATATCCAGTAATGAAGAGAGG + Intergenic
1121837279 14:97103154-97103176 CTACTCCCAGAAAAGGAGAAAGG - Intergenic
1122634615 14:103124101-103124123 GTGCAGCCAGAAAGGAAGAAGGG - Intronic
1122654819 14:103251074-103251096 CTACACTCAGGAATGAACAAGGG - Intergenic
1123800170 15:23810949-23810971 CTGCAGCCTGAAATGAAGAATGG - Intergenic
1124032431 15:26023689-26023711 CTACGCCCAGGAATGAACAAGGG + Intergenic
1124204322 15:27704196-27704218 CTACCTCTACACATGAAGAAAGG - Intergenic
1124531901 15:30516081-30516103 GTACATCGAGAAATTAACAAAGG + Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1124766753 15:32491564-32491586 GTACATCGAGAAATTAACAAAGG - Intergenic
1125391354 15:39196163-39196185 CTACACCCAGAGTTGGAGAATGG - Intergenic
1126202916 15:46008087-46008109 TTACCACCAGAAATAAAGAATGG + Intergenic
1126920558 15:53517851-53517873 ATAGATACAGAAAGGAAGAAGGG + Intronic
1128869777 15:71145619-71145641 CTGAATACAGAAAGGAAGAAAGG + Intronic
1129157029 15:73724579-73724601 TTGCATCAAGAAATGAAGTAGGG - Intergenic
1130315675 15:82793841-82793863 CTAGAATCAGAAATGAAAAAGGG - Intronic
1133001002 16:2851708-2851730 CTCCAACCAGAAATGATCAAGGG - Intergenic
1133537004 16:6711946-6711968 CTACAGCTACAAAGGAAGAATGG - Intronic
1134537068 16:15034655-15034677 CCACACCCAGTGATGAAGAACGG - Intronic
1135848076 16:25937267-25937289 ATACAGACAGAAATGAAGAAAGG + Intronic
1137302975 16:47171388-47171410 CTAAAATCAGAAATGAACAATGG - Intronic
1137380194 16:47991187-47991209 CTACACTCAGGAATGAACAAAGG + Intergenic
1139807756 16:69583793-69583815 CTACATCCAGAAAAGAAGGAAGG + Intronic
1140197697 16:72868879-72868901 TTACCTCCAGAAAGGAAGAGTGG + Intronic
1141005742 16:80349957-80349979 GGACATGCAGAGATGAAGAAAGG - Intergenic
1202994455 16_KI270728v1_random:94458-94480 CTACTGCCAGGAATGAACAAGGG + Intergenic
1203021142 16_KI270728v1_random:406800-406822 CTACTGCCAGGAATGAACAAGGG + Intergenic
1203039477 16_KI270728v1_random:679958-679980 CTACTGCCAGGAATGAACAAGGG + Intergenic
1142507198 17:371989-372011 CTACGCCCAGGAATGAACAAGGG - Intronic
1144099018 17:11927735-11927757 CTACAGCCAGGAAGGAAGAGCGG - Intronic
1144295242 17:13868642-13868664 CTACGTACAGGAATGAAGGAGGG + Intergenic
1146576651 17:33999437-33999459 CGACAACCAGAGAGGAAGAAAGG - Intronic
1147279583 17:39347951-39347973 CAAAATCAAGAAATGGAGAAAGG - Intronic
1148286001 17:46392538-46392560 CTACAAAAAGAAAGGAAGAAAGG - Intergenic
1148308168 17:46610128-46610150 CTACAAAAAGAAAGGAAGAAAGG - Intronic
1148476884 17:47934517-47934539 CTACATCAAGAAATTAACACTGG - Intergenic
1152966202 18:117020-117042 CTACATTCAGGAATGGTGAAAGG - Intergenic
1153154469 18:2132990-2133012 CCACATCCAGGAATGACCAAGGG + Intergenic
1154927770 18:20955045-20955067 CTACATTCAGGAATGGTGAAAGG + Intronic
1155579928 18:27292377-27292399 CCACCTCCTAAAATGAAGAAAGG - Intergenic
1155704169 18:28787483-28787505 CTCCATTCAGCTATGAAGAATGG - Intergenic
1156456389 18:37297007-37297029 CTACAACCAGAAATCAACTAGGG + Intronic
1156794594 18:41028130-41028152 CTACATACACGAATTAAGAAGGG - Intergenic
1156972815 18:43177267-43177289 TTATATCCAGGAATGAACAAGGG + Intergenic
1158050770 18:53216024-53216046 CTACATTTATAAAGGAAGAATGG - Intronic
1158191705 18:54836400-54836422 CACCATCTAGAACTGAAGAATGG - Intronic
1158200688 18:54936458-54936480 CCAAATCCAGAGAGGAAGAATGG + Intronic
1159090265 18:63840374-63840396 CCAGATCCAGAAATGTAGCAGGG + Intergenic
1159304557 18:66623819-66623841 TAGCATCCAGAAATGAACAATGG - Intergenic
1159726296 18:71964012-71964034 CTACACCAAGAAATAAAGATTGG - Intergenic
1159846733 18:73470028-73470050 CAAAAGCAAGAAATGAAGAAAGG - Intergenic
1160683057 19:421041-421063 CTCCATCAAGAAAGAAAGAAAGG + Intronic
1161756536 19:6138218-6138240 CGACATGAAGAAATGAAGAGGGG - Intronic
1163788548 19:19291385-19291407 CTAAAATCAGAAATGAAGGAGGG + Intronic
1164110535 19:22153244-22153266 CAAAAACAAGAAATGAAGAAAGG + Intergenic
1164486781 19:28664133-28664155 CTACAATCAGAAATGATAAAGGG - Intergenic
1166176675 19:41077662-41077684 AAACAATCAGAAATGAAGAATGG - Intergenic
1166264184 19:41667190-41667212 CTACATACAGAAATAAGCAAAGG + Intronic
925106201 2:1294574-1294596 CTCCAATCAGAAATGCAGAAAGG + Intronic
925539401 2:4950712-4950734 CGAAAGCCAGAAATGAAGATGGG + Intergenic
925539899 2:4955593-4955615 CTACATGAAGAAATGTAGAAAGG - Intergenic
925655388 2:6142184-6142206 CTACAATAAGAAATGAATAAGGG + Intergenic
927756288 2:25710891-25710913 CTAAATTCAGAAATGAAAGAGGG + Intergenic
928390936 2:30910515-30910537 CTACATTGAGAGATGAAGAATGG - Exonic
928637224 2:33259565-33259587 CTAAAACCAGAAAAGAAAAAGGG - Intronic
928810693 2:35221010-35221032 CTACATTCAAGAATGAGGAAGGG + Intergenic
928913286 2:36444557-36444579 CAGCATTCAAAAATGAAGAATGG + Intronic
929693319 2:44092745-44092767 CTCCATCAAGAAAGAAAGAAAGG - Intergenic
930630299 2:53746288-53746310 CTACATCAAAAAATAAAAAAAGG + Intronic
930776534 2:55177610-55177632 CTACTTCAAGAAATCAATAAAGG - Exonic
931178161 2:59874102-59874124 GGACATCCAGAAATTAACAAGGG - Intergenic
931621707 2:64217017-64217039 CAACATTAAGAAATGAAGAGTGG - Intergenic
931957504 2:67443809-67443831 CTATCTGCAGAAGTGAAGAATGG - Intergenic
932637588 2:73405433-73405455 CTAAATTCAGAAATGAAAGAGGG - Intronic
933523572 2:83406858-83406880 CTAAATAAAGAAATGAAGAGTGG - Intergenic
933570482 2:84005110-84005132 CTACTCCCAAAATTGAAGAAAGG + Intergenic
933765130 2:85702518-85702540 CTAGAATCAGAAATGAAGGAGGG - Intergenic
934168009 2:89313631-89313653 CTAAAACAAGCAATGAAGAAAGG + Intergenic
934199277 2:89868950-89868972 CTAAAACAAGCAATGAAGAAAGG - Intergenic
935041028 2:99427236-99427258 ATACATCCATAAAGTAAGAAAGG + Intronic
935395151 2:102599870-102599892 ATACAGAAAGAAATGAAGAATGG + Intergenic
939178103 2:138773508-138773530 CTACACACACAAATGAGGAATGG + Intronic
939468505 2:142588671-142588693 CTACACCTAGAGATGAACAAAGG + Intergenic
939755411 2:146103328-146103350 CTATGTCCAGAAATGAACAAGGG + Intergenic
939763555 2:146216108-146216130 CTAGAATCAGAAATGGAGAATGG + Intergenic
941028931 2:160490821-160490843 CTATATCAAAAACTGAAGAATGG - Intronic
941404982 2:165075859-165075881 CTACACCCAGAAATGAACATGGG + Intergenic
941456603 2:165717001-165717023 CTACTTCCAGAATTTAAGATAGG - Intergenic
942095305 2:172531496-172531518 CTACGCCCAGGAATGAACAAGGG + Intergenic
942748568 2:179264139-179264161 TTTCACCCAGAAATGAACAAGGG + Intronic
942974139 2:181994436-181994458 CTACTTCAATAAATAAAGAAAGG - Intronic
943434388 2:187846408-187846430 CTTAAAACAGAAATGAAGAAAGG + Intergenic
943441275 2:187931396-187931418 CTACAACCAGAAGTTAGGAAAGG - Intergenic
944054913 2:195513433-195513455 CGACATCCAGTGATAAAGAAAGG + Intergenic
944463805 2:199980118-199980140 TCACATCAAGAAATGGAGAAAGG - Intronic
945202840 2:207301263-207301285 CTACAATCAGAAATGAAAGAGGG + Intergenic
945555481 2:211270429-211270451 CTACATCCAGGAATGAACAAGGG - Intergenic
945555669 2:211272284-211272306 GGACATGCAGAAAGGAAGAATGG - Intergenic
945782722 2:214196493-214196515 CTAAATTCAGAATGGAAGAATGG + Intronic
947304627 2:228730506-228730528 CTACACCTAGTAATGAACAAGGG - Intergenic
948004503 2:234596147-234596169 TTACACCCAGGAATGAACAAGGG + Intergenic
948020167 2:234725708-234725730 CTACGCCCAGGAATGAACAAGGG - Intergenic
948326747 2:237128145-237128167 CTACATCCAGGACTGGAGAGGGG - Intergenic
1168922181 20:1548809-1548831 CTAGAATCAGAAATGAAGGAAGG - Intronic
1169324705 20:4665807-4665829 CTACACCCAGGAATGAACAAGGG - Intergenic
1169541874 20:6608241-6608263 CCACATCTACAAATTAAGAATGG - Intergenic
1170202092 20:13755322-13755344 TTCCATCCAGAAATAAATAATGG - Intronic
1170216648 20:13898654-13898676 CTCTACCCATAAATGAAGAATGG - Intronic
1170956966 20:20990329-20990351 CTAGAACCAAAAATGGAGAAAGG - Intergenic
1172818999 20:37715317-37715339 TTACTTGTAGAAATGAAGAATGG + Intronic
1174851640 20:54001261-54001283 CTACCCCCAGGAATGAACAAGGG - Intronic
1176297933 21:5084321-5084343 GCACAGCCAGAAATGAAGACGGG - Intergenic
1176910920 21:14564191-14564213 CTACATACTGACTTGAAGAAGGG + Intronic
1176972709 21:15285418-15285440 GTAAATCCAGAAATGAAGCTGGG - Intergenic
1177957533 21:27618309-27618331 CTACATAAAGAAAAGAAGAATGG - Intergenic
1178187634 21:30241755-30241777 CTACTTTCATAAATGAAGAAAGG + Intergenic
1179108580 21:38425377-38425399 CTCCATCAAAAAAAGAAGAAAGG + Intronic
1179859096 21:44177628-44177650 GCACAGCCAGAAATGAAGACGGG + Intergenic
1181116081 22:20633212-20633234 CTCCATCCAGAAAGGAGGCAGGG - Intergenic
1184306354 22:43605212-43605234 CTACACCCAGGAATGAGCAAGGG - Intronic
1184828413 22:46968739-46968761 CCACATCCAGAAAACAAAAAGGG - Intronic
1185191869 22:49443208-49443230 CCAAACCCAGAAATGAAGAGTGG + Intronic
949216396 3:1574243-1574265 CTAGATACAGAAGTGTAGAAAGG - Intergenic
951126630 3:18992423-18992445 TTACATTAAGAAAGGAAGAAAGG + Intergenic
952212562 3:31243067-31243089 CTACATAAACGAATGAAGAATGG - Intergenic
952577157 3:34789148-34789170 GTACAGCCAGGAAAGAAGAAAGG + Intergenic
952692522 3:36226585-36226607 CAAAAACCAGAAATGGAGAAAGG + Intergenic
953932164 3:47010854-47010876 CTTCATCCAGAAATTCAGAGAGG - Intergenic
956042683 3:65162000-65162022 CAACTTCCAGAGATGAAGCAAGG + Intergenic
956158636 3:66324667-66324689 CTACACCCAGGAATGAACAAGGG + Intronic
956914516 3:73857224-73857246 CTCCATCAAGAAAGAAAGAAAGG - Intergenic
957404409 3:79758626-79758648 CTACAGAGAGAAAAGAAGAAAGG + Intronic
957509511 3:81169418-81169440 CTCCACCCAGGAATGAACAAGGG + Intergenic
958139937 3:89549366-89549388 ATTCATGCAGAAATGAGGAATGG + Intergenic
958747502 3:98154769-98154791 CTACACTCAGGAATGAAGAAGGG - Intergenic
958758316 3:98276081-98276103 CTACATGCAGGAATGAAGAAGGG - Intergenic
960428583 3:117540346-117540368 CTACATCTAGAAAGGTAGAGAGG + Intergenic
960452541 3:117828098-117828120 CTAAGCCCAGAAATGAACAAAGG + Intergenic
960465065 3:117987943-117987965 CTTCATCCTGAAAGAAAGAAAGG - Intergenic
960615067 3:119589008-119589030 GAGCATCAAGAAATGAAGAAAGG - Exonic
960753818 3:120985768-120985790 CTAAAGTCAGAAATGAAAAATGG - Intronic
961630861 3:128297353-128297375 CTCAATCCACAAATAAAGAAAGG - Intronic
961827986 3:129608461-129608483 CTCCATCCAGAGAGGAAGACAGG - Intergenic
963019158 3:140855460-140855482 CTACACGCAGGAATGAATAAGGG + Intergenic
963088310 3:141459040-141459062 GCACAGACAGAAATGAAGAAAGG - Intergenic
963314202 3:143741857-143741879 CTACGCCCAGGAATGAACAAGGG - Intronic
963492453 3:146018361-146018383 CTGCTTCCAGAACTGGAGAAGGG - Intergenic
964254074 3:154754923-154754945 CTGAAGCCAGAAATGAAAAAAGG + Intergenic
964330661 3:155598751-155598773 CTACTTCCTGAATTGAAGTAAGG + Intronic
965855445 3:173082433-173082455 CTCCATCCAGAACTTCAGAAGGG + Intronic
966031902 3:175359840-175359862 CTAGGACCAGAAATGAAGAAAGG + Intronic
967039728 3:185680096-185680118 CTACAATCAGAAATGAAAGAGGG + Intronic
967182526 3:186918846-186918868 CTACATACACAAAAGGAGAAAGG - Intergenic
967302915 3:188033582-188033604 GTACAAATAGAAATGAAGAATGG - Intergenic
967533823 3:190579232-190579254 TTGCATAGAGAAATGAAGAAAGG - Intronic
968146408 3:196302835-196302857 CTACGCCCAGGAATGAACAAGGG - Intronic
968151956 3:196343965-196343987 CTACGCCCAGGAATGAACAAGGG + Intergenic
968210528 3:196844928-196844950 CTACGCCCAGGAATGAACAAGGG + Intergenic
968234590 3:197024180-197024202 CGCCTTCCAGGAATGAAGAATGG + Intronic
970637775 4:18028287-18028309 TTACATCCAGACATGATGATAGG + Intergenic
971193009 4:24445682-24445704 CTAGACCCAGAAATGTATAATGG - Intergenic
972812616 4:42607224-42607246 CAGAATACAGAAATGAAGAAAGG + Intronic
973714527 4:53662291-53662313 CCTCTTCCAGAAAGGAAGAATGG - Intronic
973800015 4:54468402-54468424 CTACATAAAGAAAGGAAGAATGG - Intergenic
974038277 4:56836241-56836263 GCACATCCAAAAATGAAGATGGG + Intergenic
974070947 4:57123076-57123098 CAACATCCAGCAAGGAAGCAGGG - Intergenic
974583818 4:63843415-63843437 TTAAATACAGAAATGGAGAAAGG + Intergenic
974979669 4:68939430-68939452 CAAAATCAAGAAATGGAGAAAGG + Intronic
975266275 4:72372143-72372165 CTACATTGTGAAAAGAAGAACGG + Intronic
975602965 4:76122597-76122619 CTACAAACAGAAATGTAAAATGG + Intronic
975888456 4:78994460-78994482 CAACAGTCAGAAATGAAAAAAGG - Intergenic
976302378 4:83527555-83527577 CTACACCCAGGAATGGACAAGGG - Intergenic
977487073 4:97662740-97662762 CTACATACAGACATAAAGATGGG + Intronic
978164108 4:105586041-105586063 CTTCATCCAGAAATAAAAGACGG + Intronic
979136451 4:117117304-117117326 CTAAAACCAGAAGTTAAGAAAGG - Intergenic
979358097 4:119729396-119729418 CTATTTCCAGGAATGAACAAGGG + Intergenic
979983169 4:127281748-127281770 CTACATCCAGAAGTGAAAAATGG + Intergenic
980455610 4:133038048-133038070 CTACTTCCAGCCAGGAAGAAGGG - Intergenic
980663040 4:135892286-135892308 TAAAATCCAGAAATAAAGAATGG - Intergenic
981185773 4:141801193-141801215 CTACATCCTGAAATGGCGGAAGG + Intergenic
981306417 4:143251288-143251310 CTACATCCAAGCATGTAGAAAGG - Intergenic
981404082 4:144346953-144346975 CTCCATTCAGAACTAAAGAAAGG + Intergenic
982392512 4:154880861-154880883 CTACAACTTGAAATGAAAAAAGG - Intergenic
982572445 4:157067278-157067300 CTACATCAAGGGATGAAGAGAGG + Intergenic
982843104 4:160217738-160217760 CAACATACAGAAATCAATAAAGG - Intergenic
983078533 4:163355773-163355795 CAACAGACAGAAATGAAGCAAGG + Intergenic
983329922 4:166312472-166312494 CTCTATTCAGAAAAGAAGAAAGG - Intergenic
983743162 4:171160875-171160897 AAACAGGCAGAAATGAAGAAAGG + Intergenic
983961973 4:173765639-173765661 TTACAAACAGAAATGAAAAATGG - Intergenic
984817179 4:183849684-183849706 CTACAGCCAGAAATAAAGACTGG + Intergenic
984833644 4:183999444-183999466 CCACATCCAGAAAAGGAGGAAGG - Intronic
985294707 4:188423401-188423423 CTACTTACAGAAGTGAAGCAGGG + Intergenic
986988372 5:13524373-13524395 CTAAAGCCAGGAATGAACAAGGG - Intergenic
987674571 5:21058961-21058983 ATAAAACCAGAAATGATGAAGGG - Intergenic
988312959 5:29585438-29585460 TTTCATCTAGAAATGAAGAGAGG + Intergenic
988348085 5:30066158-30066180 CAAAATACAGAAATGAAGAGAGG - Intergenic
988577511 5:32442065-32442087 CTACAGATAGAAATGAAGAAAGG - Intronic
988863463 5:35308701-35308723 TTACAGCTAGAAAAGAAGAAGGG - Intergenic
988891806 5:35625618-35625640 ATACATCCATAGATGAATAATGG + Intronic
990108703 5:52295743-52295765 CTCCATCAAAAAAAGAAGAAAGG - Intergenic
990413851 5:55567309-55567331 TTACATACAGAAGTGAATAAAGG - Intergenic
991027483 5:62045768-62045790 CTACACCCAGGGATGAATAAGGG + Intergenic
992130950 5:73692623-73692645 CAACATCCAGAAATTAGAAAAGG - Intronic
992501873 5:77351240-77351262 TTACATCCACAAATGCAGTAGGG + Intronic
995075455 5:107978227-107978249 CTACATCCAGGAATGAGTGAAGG - Intronic
995617238 5:113978728-113978750 CAAAAACAAGAAATGAAGAAAGG - Intergenic
996085984 5:119305832-119305854 CTCCATCCAAGAATGAACAAGGG - Intronic
996165785 5:120221063-120221085 ATGCAGCCAGAAAAGAAGAATGG - Intergenic
996783849 5:127217043-127217065 CTATATCCATGAATGAAGCAGGG - Intergenic
996900939 5:128540185-128540207 CTACATGGAGAAATAAAGGAGGG - Intronic
999892268 5:155991959-155991981 ATATAGACAGAAATGAAGAAAGG - Intronic
1000225368 5:159255989-159256011 CTACATGCAGGAATGAGTAAAGG - Intergenic
1001488289 5:172136094-172136116 CTACAATCAGAAATGAAAAAGGG + Intronic
1001915967 5:175560275-175560297 CTGCACCCAGGAATGAACAAGGG + Intergenic
1002369525 5:178740384-178740406 CTATATCCATGAATGAAGCAGGG + Intergenic
1004387497 6:15185305-15185327 CTCCATCAAGAAAGGAAGGAAGG + Intergenic
1004710824 6:18168694-18168716 CTACAGACAGGAATGAAAAATGG - Intronic
1006057609 6:31396926-31396948 CTACGCCTAGAAATGAAGAAGGG + Intergenic
1006070091 6:31491925-31491947 CTATGCCCAGAAATGAACAAGGG + Intergenic
1007539497 6:42627886-42627908 CTGCACCCAGGAATGAATAAGGG + Intronic
1008259945 6:49353180-49353202 CTATTTCCAAAAATCAAGAAGGG + Intergenic
1008902658 6:56639588-56639610 ATACATCCAGGAATCAAGAACGG - Exonic
1009271059 6:61614597-61614619 CTACATCCAGATAAAAGGAATGG + Intergenic
1010093443 6:72011210-72011232 CAAAAACAAGAAATGAAGAAAGG + Intronic
1010619421 6:78055813-78055835 CTACACCCAGAAGGGAAAAAGGG - Intergenic
1011218559 6:85031067-85031089 CTACAGCCTGCAATCAAGAAAGG - Intergenic
1011676650 6:89741396-89741418 CTATACCCAGGAATGAACAAGGG - Intronic
1011737639 6:90327970-90327992 CTACTTTTAGAAATGAATAATGG + Intergenic
1012168362 6:95987896-95987918 CATCAGCCAGAAATGGAGAATGG - Intergenic
1012380994 6:98619475-98619497 CTACATCTACAGATGAAGAAAGG + Intergenic
1012454214 6:99386591-99386613 CAATATCAAGAAATAAAGAAAGG + Intronic
1013859586 6:114619200-114619222 CAACAACCTGAAATAAAGAAAGG + Intergenic
1013875843 6:114826879-114826901 CCACATAAAAAAATGAAGAATGG + Intergenic
1016462927 6:144296911-144296933 CTAGAGCCAAAAATCAAGAAAGG - Intronic
1016680638 6:146825111-146825133 CTACATACAGGAATGAGAAAAGG + Intergenic
1017403476 6:154091316-154091338 TTTCATCCAGAAATGCATAAAGG - Exonic
1019593208 7:1846108-1846130 CAGCGTCCAGAACTGAAGAAGGG + Intronic
1019799448 7:3077599-3077621 GTACACCCGGAAATGCAGAAGGG - Intergenic
1021246700 7:18271911-18271933 ATGCATCCATAAATGAAGGAAGG + Intronic
1021421893 7:20454984-20455006 TTACGTCAAGAAATGAAGGAAGG - Intergenic
1025258362 7:57400201-57400223 CAACACCCAGAAAGGAAAAAGGG + Intergenic
1025610274 7:63071521-63071543 CAACACCCAGAAAGGAAAAAGGG - Intergenic
1026870585 7:73848843-73848865 CTCCATCAAGAAAGGAAGGAAGG - Intergenic
1027506550 7:79022663-79022685 CCACATTCAGAAATGACAAAGGG + Intronic
1027680440 7:81213954-81213976 CTACAACCAGACATGAGAAAGGG + Intergenic
1029000921 7:97153114-97153136 CTACACCTAGGAATGAACAAGGG + Intronic
1029034920 7:97509354-97509376 CTAGATCCAGCCATGGAGAAGGG - Intergenic
1030567868 7:111183100-111183122 CTAAACCAAAAAATGAAGAAAGG + Intronic
1031088534 7:117325404-117325426 CTAAATCCAGATGTGAAAAAGGG + Intergenic
1032669677 7:134071729-134071751 CTACATGCAGGAATGAGCAAAGG + Intergenic
1035057712 7:156046991-156047013 GTACAGACAGAAATGAAGGAAGG + Intergenic
1035676305 8:1458781-1458803 CTGCATCCAGACATGAAAACAGG + Intergenic
1036662971 8:10720112-10720134 CTACATCAAAAAAAGAAAAAGGG + Intergenic
1036677169 8:10844114-10844136 CTACACCCAGGAATGAACAAGGG - Intergenic
1037832492 8:22197671-22197693 CAGCACCCAGAAGTGAAGAAGGG + Intronic
1038603631 8:28975444-28975466 ATTCATCCAGATATTAAGAAAGG + Intronic
1038875126 8:31540070-31540092 CCACAGAAAGAAATGAAGAAAGG + Intergenic
1039210724 8:35210832-35210854 AAACATCCTAAAATGAAGAATGG + Intergenic
1039331986 8:36547561-36547583 GTACATGAAGAAATGAAGCATGG - Intergenic
1040021500 8:42745244-42745266 CTACGTCCAGGGATGAACAATGG - Intergenic
1040614945 8:49025727-49025749 CTGCATGCAGAAAGGAAGGATGG + Intergenic
1040709913 8:50175681-50175703 ATACATGAAGAAATGGAGAAAGG + Intronic
1040912805 8:52538149-52538171 CTACAGCGAGACATGAGGAACGG + Intronic
1041625549 8:60022072-60022094 CTACAAACAGAATTTAAGAAAGG + Intergenic
1042716595 8:71779931-71779953 CTCAATCTAGAAAGGAAGAAAGG + Intergenic
1043220812 8:77661530-77661552 CTACGACCAGAAATGAAGAAGGG - Intergenic
1043229242 8:77779231-77779253 TTACATACAGAAATGAAACAAGG - Intergenic
1043565908 8:81547314-81547336 CTACATAGGGAAATGAAGAGAGG - Intergenic
1043991852 8:86765283-86765305 CTACATCCAGGAATGACCAAAGG - Intergenic
1044032726 8:87258363-87258385 CTACACACACAAATAAAGAAGGG - Intronic
1044460958 8:92443471-92443493 CAACCCCCAGAAATGAAGACTGG + Intergenic
1044830365 8:96241654-96241676 CCACATCCATAAAAAAAGAAGGG - Intronic
1045746119 8:105424344-105424366 TTGCATCTAGATATGAAGAATGG + Intronic
1046664461 8:116985139-116985161 TAACATGCAGAAATGTAGAAAGG + Intronic
1048822206 8:138391009-138391031 CTACTTCCCAAGATGAAGAATGG + Intronic
1050154529 9:2651940-2651962 CTACTTACAGAGAGGAAGAATGG - Exonic
1052152727 9:25139026-25139048 CTCCTTCCATAAATGAAGCAAGG + Intergenic
1052697119 9:31891920-31891942 CTGCATCCAAAAATGAAGCATGG + Intergenic
1052723621 9:32202753-32202775 CAAAATCCAGCAAGGAAGAAAGG + Intergenic
1053118155 9:35523941-35523963 CTAAATCAATAAATTAAGAAAGG + Intronic
1053186237 9:36018917-36018939 CAAAAGCCAGAATTGAAGAATGG + Intergenic
1054361385 9:64123924-64123946 CTGCATTTAGAAATGAAGTAGGG + Intergenic
1054590443 9:67005116-67005138 CTACATCCAGAAGTCAGGAGTGG + Intergenic
1055889682 9:81109409-81109431 CTACTTTCAGAACTGAAGCAAGG + Intergenic
1056483766 9:87033604-87033626 GTAAATCCAGAAAAGAAGAAGGG + Intergenic
1057398758 9:94703810-94703832 CCACATGCAGAAATGAGTAAAGG - Intergenic
1057442462 9:95091966-95091988 ATAGATCCAGAAGAGAAGAAAGG + Intergenic
1058071435 9:100604538-100604560 CTACATGATGAAATGAAGTAAGG - Intergenic
1058422368 9:104844131-104844153 CTAAGGCCAGAAATGAACAAGGG + Intronic
1060205316 9:121679393-121679415 GTACATGCACAAATGCAGAAGGG - Intronic
1060206531 9:121685753-121685775 CTACCTGCAGAAATACAGAAGGG + Intronic
1060262601 9:122089703-122089725 CTTCATGCAGTAATGAGGAAGGG + Intronic
1060512853 9:124246640-124246662 CTCCATCCCGAAATGAACATGGG - Intergenic
1061776058 9:132965269-132965291 CTGCTTCCAGAAATGCAGCAGGG + Intronic
1062131776 9:134899190-134899212 CTACATCCAAAATTGCACAAGGG + Intergenic
1188346441 X:29072339-29072361 CTTCACTCATAAATGAAGAAAGG + Intronic
1188375946 X:29427987-29428009 CTACATCCAGGAATGAGCAAGGG + Intronic
1188620708 X:32219789-32219811 CAGGATCCTGAAATGAAGAATGG - Intronic
1188783594 X:34315322-34315344 CTAGATACAGAAGGGAAGAAGGG - Intergenic
1188879362 X:35472763-35472785 GTACATACAGACATAAAGAAGGG - Intergenic
1190368611 X:49720836-49720858 CTACACCTAGGAATGAACAAGGG - Intergenic
1192075872 X:67995798-67995820 CAAAAACAAGAAATGAAGAAAGG - Intergenic
1193060507 X:77201430-77201452 ATACAATCAGAAATGATGAAGGG - Intergenic
1194359900 X:92937387-92937409 CTACACCCAGGTATGAACAAGGG - Intergenic
1194519822 X:94905057-94905079 CTACATAAAGAAAGGAAGAGTGG - Intergenic
1195385758 X:104312311-104312333 GTACATTCAGAAATGAAGCCAGG - Intergenic
1195631768 X:107063691-107063713 CTAAAATCAGAAATGAAGGAGGG - Intergenic
1196236950 X:113292973-113292995 CGACTTCCAGAATTGAAGAAAGG + Intergenic
1196996645 X:121390709-121390731 CTGGGTCCAGAGATGAAGAATGG + Intergenic
1197179957 X:123523610-123523632 CTCCCACCAGCAATGAAGAAGGG + Intergenic
1199703929 X:150407401-150407423 CAACATGCATAATTGAAGAAAGG + Intronic
1200668100 Y:6053208-6053230 CTACACCCAGGTATGAACAAAGG - Intergenic
1200756154 Y:6991840-6991862 CAACTTACAGAAATGGAGAAGGG + Intronic
1200867139 Y:8056755-8056777 CAACAACAAGAAATGGAGAAGGG - Intergenic
1202277582 Y:23140363-23140385 CTATATCCTGAAATATAGAAGGG + Intronic
1202277738 Y:23142744-23142766 CTACATCCAGAAATGAAGAATGG + Intronic
1202278634 Y:23152536-23152558 CTATATCCACAAATGAAGAAGGG + Intronic
1202286104 Y:23249073-23249095 CTATATCCACAAATGAAGAAGGG - Intronic
1202286569 Y:23256228-23256250 CTATATCCACAAATGAAGAAGGG - Intronic
1202287465 Y:23266023-23266045 CTACATCCAGAAATGAAGAATGG - Intronic
1202287630 Y:23268407-23268429 CTACATCCAGAAATGAAGAATGG - Intronic
1202287795 Y:23270792-23270814 CTACATCCAGAAATGAAGAATGG - Intronic
1202287959 Y:23273176-23273198 CTACATCCAGAAATGAAGAATGG - Intronic
1202288125 Y:23275560-23275582 CTACATCCAGAAATGAAGAATGG - Intronic
1202288289 Y:23277944-23277966 CTACATCCAGAAATGAAGAATGG - Intronic
1202288446 Y:23280325-23280347 CTATATCCTGAAATATAGAAGGG - Intronic
1202430573 Y:24774087-24774109 CTATATCCTGAAATATAGAAGGG + Intronic
1202431458 Y:24783876-24783898 CTATATCCACAAATGAAGAAGGG + Intronic
1202431761 Y:24788633-24788655 CTATATCCACAAATGAAGAAGGG + Intronic
1202432064 Y:24793389-24793411 CTATATCCACAAATGAAGAAGGG + Intronic
1202438204 Y:24869529-24869551 CTATATCCACAAATGAAGAAGGG - Intronic
1202438507 Y:24874286-24874308 CTATATCCACAAATGAAGAAGGG - Intronic
1202439405 Y:24884080-24884102 CTACATCCAGAAATGAAGAATGG - Intronic
1202439569 Y:24886465-24886487 CTACATCCAGAAATGAAGAATGG - Intronic
1202439734 Y:24888850-24888872 CTACATCCAGAAATGAAGAATGG - Intronic
1202439899 Y:24891234-24891256 CTACATCCAGAAATGAAGAATGG - Intronic
1202440064 Y:24893619-24893641 CTACATCCAGAAATGAAGAATGG - Intronic
1202440219 Y:24896000-24896022 CTATATCCTGAAATATAGAAGGG - Intronic