ID: 1202289484 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Y:23294080-23294102 |
| Sequence | TGAGAATGGGGCCCAGGATT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1202289484_1202289490 | 5 | Left | 1202289484 | Y:23294080-23294102 | CCAAATCCTGGGCCCCATTCTCA | No data | ||
| Right | 1202289490 | Y:23294108-23294130 | TCTTATTCTAATGCTCTGGATGG | No data | ||||
| 1202289484_1202289491 | 6 | Left | 1202289484 | Y:23294080-23294102 | CCAAATCCTGGGCCCCATTCTCA | No data | ||
| Right | 1202289491 | Y:23294109-23294131 | CTTATTCTAATGCTCTGGATGGG | No data | ||||
| 1202289484_1202289489 | 1 | Left | 1202289484 | Y:23294080-23294102 | CCAAATCCTGGGCCCCATTCTCA | No data | ||
| Right | 1202289489 | Y:23294104-23294126 | ATGCTCTTATTCTAATGCTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1202289484 | Original CRISPR | TGAGAATGGGGCCCAGGATT TGG (reversed) | Intergenic | ||