ID: 1202289485

View in Genome Browser
Species Human (GRCh38)
Location Y:23294086-23294108
Sequence AGCATCTGAGAATGGGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202289485_1202289491 0 Left 1202289485 Y:23294086-23294108 CCTGGGCCCCATTCTCAGATGCT No data
Right 1202289491 Y:23294109-23294131 CTTATTCTAATGCTCTGGATGGG No data
1202289485_1202289490 -1 Left 1202289485 Y:23294086-23294108 CCTGGGCCCCATTCTCAGATGCT No data
Right 1202289490 Y:23294108-23294130 TCTTATTCTAATGCTCTGGATGG No data
1202289485_1202289489 -5 Left 1202289485 Y:23294086-23294108 CCTGGGCCCCATTCTCAGATGCT No data
Right 1202289489 Y:23294104-23294126 ATGCTCTTATTCTAATGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202289485 Original CRISPR AGCATCTGAGAATGGGGCCC AGG (reversed) Intergenic