ID: 1202289487

View in Genome Browser
Species Human (GRCh38)
Location Y:23294093-23294115
Sequence GAATAAGAGCATCTGAGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202289487_1202289491 -7 Left 1202289487 Y:23294093-23294115 CCCATTCTCAGATGCTCTTATTC No data
Right 1202289491 Y:23294109-23294131 CTTATTCTAATGCTCTGGATGGG No data
1202289487_1202289490 -8 Left 1202289487 Y:23294093-23294115 CCCATTCTCAGATGCTCTTATTC No data
Right 1202289490 Y:23294108-23294130 TCTTATTCTAATGCTCTGGATGG No data
1202289487_1202289494 27 Left 1202289487 Y:23294093-23294115 CCCATTCTCAGATGCTCTTATTC No data
Right 1202289494 Y:23294143-23294165 GCATTTTTAACATGTGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202289487 Original CRISPR GAATAAGAGCATCTGAGAAT GGG (reversed) Intergenic