ID: 1202289488 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | Y:23294094-23294116 |
Sequence | AGAATAAGAGCATCTGAGAA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1202289488_1202289494 | 26 | Left | 1202289488 | Y:23294094-23294116 | CCATTCTCAGATGCTCTTATTCT | No data | ||
Right | 1202289494 | Y:23294143-23294165 | GCATTTTTAACATGTGCCCCAGG | No data | ||||
1202289488_1202289490 | -9 | Left | 1202289488 | Y:23294094-23294116 | CCATTCTCAGATGCTCTTATTCT | No data | ||
Right | 1202289490 | Y:23294108-23294130 | TCTTATTCTAATGCTCTGGATGG | No data | ||||
1202289488_1202289491 | -8 | Left | 1202289488 | Y:23294094-23294116 | CCATTCTCAGATGCTCTTATTCT | No data | ||
Right | 1202289491 | Y:23294109-23294131 | CTTATTCTAATGCTCTGGATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1202289488 | Original CRISPR | AGAATAAGAGCATCTGAGAA TGG (reversed) | Intergenic | ||