ID: 1202289488

View in Genome Browser
Species Human (GRCh38)
Location Y:23294094-23294116
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202289488_1202289494 26 Left 1202289488 Y:23294094-23294116 CCATTCTCAGATGCTCTTATTCT No data
Right 1202289494 Y:23294143-23294165 GCATTTTTAACATGTGCCCCAGG No data
1202289488_1202289490 -9 Left 1202289488 Y:23294094-23294116 CCATTCTCAGATGCTCTTATTCT No data
Right 1202289490 Y:23294108-23294130 TCTTATTCTAATGCTCTGGATGG No data
1202289488_1202289491 -8 Left 1202289488 Y:23294094-23294116 CCATTCTCAGATGCTCTTATTCT No data
Right 1202289491 Y:23294109-23294131 CTTATTCTAATGCTCTGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202289488 Original CRISPR AGAATAAGAGCATCTGAGAA TGG (reversed) Intergenic