ID: 1202289491

View in Genome Browser
Species Human (GRCh38)
Location Y:23294109-23294131
Sequence CTTATTCTAATGCTCTGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202289484_1202289491 6 Left 1202289484 Y:23294080-23294102 CCAAATCCTGGGCCCCATTCTCA No data
Right 1202289491 Y:23294109-23294131 CTTATTCTAATGCTCTGGATGGG No data
1202289486_1202289491 -6 Left 1202289486 Y:23294092-23294114 CCCCATTCTCAGATGCTCTTATT No data
Right 1202289491 Y:23294109-23294131 CTTATTCTAATGCTCTGGATGGG No data
1202289487_1202289491 -7 Left 1202289487 Y:23294093-23294115 CCCATTCTCAGATGCTCTTATTC No data
Right 1202289491 Y:23294109-23294131 CTTATTCTAATGCTCTGGATGGG No data
1202289485_1202289491 0 Left 1202289485 Y:23294086-23294108 CCTGGGCCCCATTCTCAGATGCT No data
Right 1202289491 Y:23294109-23294131 CTTATTCTAATGCTCTGGATGGG No data
1202289488_1202289491 -8 Left 1202289488 Y:23294094-23294116 CCATTCTCAGATGCTCTTATTCT No data
Right 1202289491 Y:23294109-23294131 CTTATTCTAATGCTCTGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202289491 Original CRISPR CTTATTCTAATGCTCTGGAT GGG Intergenic