ID: 1202289494

View in Genome Browser
Species Human (GRCh38)
Location Y:23294143-23294165
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202289486_1202289494 28 Left 1202289486 Y:23294092-23294114 CCCCATTCTCAGATGCTCTTATT No data
Right 1202289494 Y:23294143-23294165 GCATTTTTAACATGTGCCCCAGG No data
1202289487_1202289494 27 Left 1202289487 Y:23294093-23294115 CCCATTCTCAGATGCTCTTATTC No data
Right 1202289494 Y:23294143-23294165 GCATTTTTAACATGTGCCCCAGG No data
1202289488_1202289494 26 Left 1202289488 Y:23294094-23294116 CCATTCTCAGATGCTCTTATTCT No data
Right 1202289494 Y:23294143-23294165 GCATTTTTAACATGTGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202289494 Original CRISPR GCATTTTTAACATGTGCCCC AGG Intergenic
No off target data available for this crispr