ID: 1202290185

View in Genome Browser
Species Human (GRCh38)
Location Y:23301812-23301834
Sequence CAGTTTAGCCTCAGGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202290175_1202290185 19 Left 1202290175 Y:23301770-23301792 CCTTGGGGATGTTCAGTCACTAG No data
Right 1202290185 Y:23301812-23301834 CAGTTTAGCCTCAGGGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202290185 Original CRISPR CAGTTTAGCCTCAGGGATGA AGG Intergenic
No off target data available for this crispr