ID: 1202292996

View in Genome Browser
Species Human (GRCh38)
Location Y:23332068-23332090
Sequence TTACACAGCTTGGAAATGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202292988_1202292996 23 Left 1202292988 Y:23332022-23332044 CCTGAGGAAACTGATGTTTGGAG No data
Right 1202292996 Y:23332068-23332090 TTACACAGCTTGGAAATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202292996 Original CRISPR TTACACAGCTTGGAAATGAG AGG Intergenic
No off target data available for this crispr