ID: 1202293334

View in Genome Browser
Species Human (GRCh38)
Location Y:23334590-23334612
Sequence TCAAGCGGGCCCGCAAGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202293334_1202293343 0 Left 1202293334 Y:23334590-23334612 CCGGCGCTTGCGGGCCCGCTTGA No data
Right 1202293343 Y:23334613-23334635 GTTCCGGGTGGGTGTGGGCTTGG 0: 63
1: 709
2: 625
3: 344
4: 428
1202293334_1202293341 -6 Left 1202293334 Y:23334590-23334612 CCGGCGCTTGCGGGCCCGCTTGA No data
Right 1202293341 Y:23334607-23334629 GCTTGAGTTCCGGGTGGGTGTGG No data
1202293334_1202293342 -5 Left 1202293334 Y:23334590-23334612 CCGGCGCTTGCGGGCCCGCTTGA No data
Right 1202293342 Y:23334608-23334630 CTTGAGTTCCGGGTGGGTGTGGG No data
1202293334_1202293346 15 Left 1202293334 Y:23334590-23334612 CCGGCGCTTGCGGGCCCGCTTGA No data
Right 1202293346 Y:23334628-23334650 GGGCTTGGCAGGCCCGCACTCGG No data
1202293334_1202293345 4 Left 1202293334 Y:23334590-23334612 CCGGCGCTTGCGGGCCCGCTTGA No data
Right 1202293345 Y:23334617-23334639 CGGGTGGGTGTGGGCTTGGCAGG 0: 26
1: 421
2: 518
3: 423
4: 706

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202293334 Original CRISPR TCAAGCGGGCCCGCAAGCGC CGG (reversed) Intergenic
No off target data available for this crispr