ID: 1202295018

View in Genome Browser
Species Human (GRCh38)
Location Y:23346796-23346818
Sequence GGGCGAAGGATGCTGAGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202295018_1202295026 12 Left 1202295018 Y:23346796-23346818 CCCATGCTCAGCATCCTTCGCCC No data
Right 1202295026 Y:23346831-23346853 CAGCATCCTGGCTTTCTTTGAGG No data
1202295018_1202295027 13 Left 1202295018 Y:23346796-23346818 CCCATGCTCAGCATCCTTCGCCC No data
Right 1202295027 Y:23346832-23346854 AGCATCCTGGCTTTCTTTGAGGG No data
1202295018_1202295024 0 Left 1202295018 Y:23346796-23346818 CCCATGCTCAGCATCCTTCGCCC No data
Right 1202295024 Y:23346819-23346841 TTTTTCTGGTGCCAGCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202295018 Original CRISPR GGGCGAAGGATGCTGAGCAT GGG (reversed) Intergenic
No off target data available for this crispr