ID: 1202295018 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | Y:23346796-23346818 |
Sequence | GGGCGAAGGATGCTGAGCAT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1202295018_1202295027 | 13 | Left | 1202295018 | Y:23346796-23346818 | CCCATGCTCAGCATCCTTCGCCC | No data | ||
Right | 1202295027 | Y:23346832-23346854 | AGCATCCTGGCTTTCTTTGAGGG | No data | ||||
1202295018_1202295026 | 12 | Left | 1202295018 | Y:23346796-23346818 | CCCATGCTCAGCATCCTTCGCCC | No data | ||
Right | 1202295026 | Y:23346831-23346853 | CAGCATCCTGGCTTTCTTTGAGG | No data | ||||
1202295018_1202295024 | 0 | Left | 1202295018 | Y:23346796-23346818 | CCCATGCTCAGCATCCTTCGCCC | No data | ||
Right | 1202295024 | Y:23346819-23346841 | TTTTTCTGGTGCCAGCATCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1202295018 | Original CRISPR | GGGCGAAGGATGCTGAGCAT GGG (reversed) | Intergenic | ||