ID: 1202295018 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Y:23346796-23346818 |
| Sequence | GGGCGAAGGATGCTGAGCAT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1202295018_1202295024 | 0 | Left | 1202295018 | Y:23346796-23346818 | CCCATGCTCAGCATCCTTCGCCC | No data | ||
| Right | 1202295024 | Y:23346819-23346841 | TTTTTCTGGTGCCAGCATCCTGG | No data | ||||
| 1202295018_1202295026 | 12 | Left | 1202295018 | Y:23346796-23346818 | CCCATGCTCAGCATCCTTCGCCC | No data | ||
| Right | 1202295026 | Y:23346831-23346853 | CAGCATCCTGGCTTTCTTTGAGG | No data | ||||
| 1202295018_1202295027 | 13 | Left | 1202295018 | Y:23346796-23346818 | CCCATGCTCAGCATCCTTCGCCC | No data | ||
| Right | 1202295027 | Y:23346832-23346854 | AGCATCCTGGCTTTCTTTGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1202295018 | Original CRISPR | GGGCGAAGGATGCTGAGCAT GGG (reversed) | Intergenic | ||