ID: 1202295026

View in Genome Browser
Species Human (GRCh38)
Location Y:23346831-23346853
Sequence CAGCATCCTGGCTTTCTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202295022_1202295026 -8 Left 1202295022 Y:23346816-23346838 CCCTTTTTCTGGTGCCAGCATCC No data
Right 1202295026 Y:23346831-23346853 CAGCATCCTGGCTTTCTTTGAGG No data
1202295023_1202295026 -9 Left 1202295023 Y:23346817-23346839 CCTTTTTCTGGTGCCAGCATCCT No data
Right 1202295026 Y:23346831-23346853 CAGCATCCTGGCTTTCTTTGAGG No data
1202295016_1202295026 16 Left 1202295016 Y:23346792-23346814 CCTCCCCATGCTCAGCATCCTTC No data
Right 1202295026 Y:23346831-23346853 CAGCATCCTGGCTTTCTTTGAGG No data
1202295017_1202295026 13 Left 1202295017 Y:23346795-23346817 CCCCATGCTCAGCATCCTTCGCC No data
Right 1202295026 Y:23346831-23346853 CAGCATCCTGGCTTTCTTTGAGG No data
1202295019_1202295026 11 Left 1202295019 Y:23346797-23346819 CCATGCTCAGCATCCTTCGCCCT No data
Right 1202295026 Y:23346831-23346853 CAGCATCCTGGCTTTCTTTGAGG No data
1202295018_1202295026 12 Left 1202295018 Y:23346796-23346818 CCCATGCTCAGCATCCTTCGCCC No data
Right 1202295026 Y:23346831-23346853 CAGCATCCTGGCTTTCTTTGAGG No data
1202295021_1202295026 -2 Left 1202295021 Y:23346810-23346832 CCTTCGCCCTTTTTCTGGTGCCA No data
Right 1202295026 Y:23346831-23346853 CAGCATCCTGGCTTTCTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202295026 Original CRISPR CAGCATCCTGGCTTTCTTTG AGG Intergenic
No off target data available for this crispr