ID: 1202295805

View in Genome Browser
Species Human (GRCh38)
Location Y:23355618-23355640
Sequence CCGTGGTGGCATGCACCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202295800_1202295805 -7 Left 1202295800 Y:23355602-23355624 CCCCAAATCTTGCTGACCGTGGT No data
Right 1202295805 Y:23355618-23355640 CCGTGGTGGCATGCACCTGCAGG No data
1202295801_1202295805 -8 Left 1202295801 Y:23355603-23355625 CCCAAATCTTGCTGACCGTGGTG No data
Right 1202295805 Y:23355618-23355640 CCGTGGTGGCATGCACCTGCAGG No data
1202295797_1202295805 10 Left 1202295797 Y:23355585-23355607 CCTGTCTCTACAAAAACCCCCAA No data
Right 1202295805 Y:23355618-23355640 CCGTGGTGGCATGCACCTGCAGG No data
1202295802_1202295805 -9 Left 1202295802 Y:23355604-23355626 CCAAATCTTGCTGACCGTGGTGG No data
Right 1202295805 Y:23355618-23355640 CCGTGGTGGCATGCACCTGCAGG No data
1202295796_1202295805 11 Left 1202295796 Y:23355584-23355606 CCCTGTCTCTACAAAAACCCCCA No data
Right 1202295805 Y:23355618-23355640 CCGTGGTGGCATGCACCTGCAGG No data
1202295798_1202295805 -6 Left 1202295798 Y:23355601-23355623 CCCCCAAATCTTGCTGACCGTGG No data
Right 1202295805 Y:23355618-23355640 CCGTGGTGGCATGCACCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202295805 Original CRISPR CCGTGGTGGCATGCACCTGC AGG Intergenic
No off target data available for this crispr