ID: 1202302964

View in Genome Browser
Species Human (GRCh38)
Location Y:23437238-23437260
Sequence TGTGGCTCCTTGGGAAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202302964_1202302969 5 Left 1202302964 Y:23437238-23437260 CCTCTTTTTCCCAAGGAGCCACA No data
Right 1202302969 Y:23437266-23437288 CTTTCACCCCACTAGCTGTTGGG No data
1202302964_1202302974 18 Left 1202302964 Y:23437238-23437260 CCTCTTTTTCCCAAGGAGCCACA No data
Right 1202302974 Y:23437279-23437301 AGCTGTTGGGTATTTTTTGGTGG No data
1202302964_1202302968 4 Left 1202302964 Y:23437238-23437260 CCTCTTTTTCCCAAGGAGCCACA No data
Right 1202302968 Y:23437265-23437287 GCTTTCACCCCACTAGCTGTTGG No data
1202302964_1202302973 15 Left 1202302964 Y:23437238-23437260 CCTCTTTTTCCCAAGGAGCCACA No data
Right 1202302973 Y:23437276-23437298 ACTAGCTGTTGGGTATTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202302964 Original CRISPR TGTGGCTCCTTGGGAAAAAG AGG (reversed) Intergenic
No off target data available for this crispr