ID: 1202309554

View in Genome Browser
Species Human (GRCh38)
Location Y:23513295-23513317
Sequence GAGGTAATATACATAGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202309550_1202309554 6 Left 1202309550 Y:23513266-23513288 CCTGATGGGGTGTATTCCAATTA No data
Right 1202309554 Y:23513295-23513317 GAGGTAATATACATAGAACAAGG No data
1202309552_1202309554 -10 Left 1202309552 Y:23513282-23513304 CCAATTACAACCAGAGGTAATAT No data
Right 1202309554 Y:23513295-23513317 GAGGTAATATACATAGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202309554 Original CRISPR GAGGTAATATACATAGAACA AGG Intergenic
No off target data available for this crispr