ID: 1202312394

View in Genome Browser
Species Human (GRCh38)
Location Y:23540989-23541011
Sequence TAGCAGTATTCTTTGATGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202312394_1202312398 0 Left 1202312394 Y:23540989-23541011 CCTATCATCAAAGAATACTGCTA No data
Right 1202312398 Y:23541012-23541034 GGGACTTTTAGAAAAATTAAGGG No data
1202312394_1202312400 21 Left 1202312394 Y:23540989-23541011 CCTATCATCAAAGAATACTGCTA No data
Right 1202312400 Y:23541033-23541055 GGGAATTATCTAGCAAACACAGG No data
1202312394_1202312399 1 Left 1202312394 Y:23540989-23541011 CCTATCATCAAAGAATACTGCTA No data
Right 1202312399 Y:23541013-23541035 GGACTTTTAGAAAAATTAAGGGG No data
1202312394_1202312401 30 Left 1202312394 Y:23540989-23541011 CCTATCATCAAAGAATACTGCTA No data
Right 1202312401 Y:23541042-23541064 CTAGCAAACACAGGATTAAGAGG No data
1202312394_1202312397 -1 Left 1202312394 Y:23540989-23541011 CCTATCATCAAAGAATACTGCTA No data
Right 1202312397 Y:23541011-23541033 AGGGACTTTTAGAAAAATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202312394 Original CRISPR TAGCAGTATTCTTTGATGAT AGG (reversed) Intergenic
No off target data available for this crispr