ID: 1202312400

View in Genome Browser
Species Human (GRCh38)
Location Y:23541033-23541055
Sequence GGGAATTATCTAGCAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202312394_1202312400 21 Left 1202312394 Y:23540989-23541011 CCTATCATCAAAGAATACTGCTA No data
Right 1202312400 Y:23541033-23541055 GGGAATTATCTAGCAAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202312400 Original CRISPR GGGAATTATCTAGCAAACAC AGG Intergenic
No off target data available for this crispr