ID: 1202315347

View in Genome Browser
Species Human (GRCh38)
Location Y:23571353-23571375
Sequence CTGAGCTGCAGTTGTGCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202315347_1202315348 3 Left 1202315347 Y:23571353-23571375 CCATATGCACAACTGCAGCTCAG No data
Right 1202315348 Y:23571379-23571401 AGCATGCTGCTGTCATTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202315347 Original CRISPR CTGAGCTGCAGTTGTGCATA TGG (reversed) Intergenic
No off target data available for this crispr