ID: 1202318816

View in Genome Browser
Species Human (GRCh38)
Location Y:23610145-23610167
Sequence CTTTCCTTGCTGGAGATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202318809_1202318816 13 Left 1202318809 Y:23610109-23610131 CCACTTTCTTATTCCAGCCTTCT No data
Right 1202318816 Y:23610145-23610167 CTTTCCTTGCTGGAGATGGAGGG No data
1202318811_1202318816 -4 Left 1202318811 Y:23610126-23610148 CCTTCTTTAAGATTACCAACTTT No data
Right 1202318816 Y:23610145-23610167 CTTTCCTTGCTGGAGATGGAGGG No data
1202318808_1202318816 14 Left 1202318808 Y:23610108-23610130 CCCACTTTCTTATTCCAGCCTTC No data
Right 1202318816 Y:23610145-23610167 CTTTCCTTGCTGGAGATGGAGGG No data
1202318810_1202318816 0 Left 1202318810 Y:23610122-23610144 CCAGCCTTCTTTAAGATTACCAA No data
Right 1202318816 Y:23610145-23610167 CTTTCCTTGCTGGAGATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202318816 Original CRISPR CTTTCCTTGCTGGAGATGGA GGG Intergenic
No off target data available for this crispr