ID: 1202320276

View in Genome Browser
Species Human (GRCh38)
Location Y:23626382-23626404
Sequence CTGTTTCCACAGAGTCATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202320276_1202320278 27 Left 1202320276 Y:23626382-23626404 CCTTCATGACTCTGTGGAAACAG No data
Right 1202320278 Y:23626432-23626454 ACCTTATAGAGCAACCCCTCTGG No data
1202320276_1202320280 28 Left 1202320276 Y:23626382-23626404 CCTTCATGACTCTGTGGAAACAG No data
Right 1202320280 Y:23626433-23626455 CCTTATAGAGCAACCCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202320276 Original CRISPR CTGTTTCCACAGAGTCATGA AGG (reversed) Intergenic
No off target data available for this crispr