ID: 1202320531

View in Genome Browser
Species Human (GRCh38)
Location Y:23628425-23628447
Sequence TGACCCATGAATTTTAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202320531_1202320533 8 Left 1202320531 Y:23628425-23628447 CCTCTTTTAAAATTCATGGGTCA No data
Right 1202320533 Y:23628456-23628478 AAACCTGCTACACCAAACCAAGG No data
1202320531_1202320538 26 Left 1202320531 Y:23628425-23628447 CCTCTTTTAAAATTCATGGGTCA No data
Right 1202320538 Y:23628474-23628496 CAAGGTCTCATCCTCCCATTGGG No data
1202320531_1202320539 27 Left 1202320531 Y:23628425-23628447 CCTCTTTTAAAATTCATGGGTCA No data
Right 1202320539 Y:23628475-23628497 AAGGTCTCATCCTCCCATTGGGG No data
1202320531_1202320537 25 Left 1202320531 Y:23628425-23628447 CCTCTTTTAAAATTCATGGGTCA No data
Right 1202320537 Y:23628473-23628495 CCAAGGTCTCATCCTCCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202320531 Original CRISPR TGACCCATGAATTTTAAAAG AGG (reversed) Intergenic
No off target data available for this crispr