ID: 1202320533

View in Genome Browser
Species Human (GRCh38)
Location Y:23628456-23628478
Sequence AAACCTGCTACACCAAACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202320525_1202320533 27 Left 1202320525 Y:23628406-23628428 CCCAAATTCCTACCTGAGACCTC No data
Right 1202320533 Y:23628456-23628478 AAACCTGCTACACCAAACCAAGG No data
1202320531_1202320533 8 Left 1202320531 Y:23628425-23628447 CCTCTTTTAAAATTCATGGGTCA No data
Right 1202320533 Y:23628456-23628478 AAACCTGCTACACCAAACCAAGG No data
1202320527_1202320533 19 Left 1202320527 Y:23628414-23628436 CCTACCTGAGACCTCTTTTAAAA No data
Right 1202320533 Y:23628456-23628478 AAACCTGCTACACCAAACCAAGG No data
1202320528_1202320533 15 Left 1202320528 Y:23628418-23628440 CCTGAGACCTCTTTTAAAATTCA No data
Right 1202320533 Y:23628456-23628478 AAACCTGCTACACCAAACCAAGG No data
1202320526_1202320533 26 Left 1202320526 Y:23628407-23628429 CCAAATTCCTACCTGAGACCTCT No data
Right 1202320533 Y:23628456-23628478 AAACCTGCTACACCAAACCAAGG No data
1202320524_1202320533 28 Left 1202320524 Y:23628405-23628427 CCCCAAATTCCTACCTGAGACCT No data
Right 1202320533 Y:23628456-23628478 AAACCTGCTACACCAAACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202320533 Original CRISPR AAACCTGCTACACCAAACCA AGG Intergenic
No off target data available for this crispr