ID: 1202320537

View in Genome Browser
Species Human (GRCh38)
Location Y:23628473-23628495
Sequence CCAAGGTCTCATCCTCCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202320531_1202320537 25 Left 1202320531 Y:23628425-23628447 CCTCTTTTAAAATTCATGGGTCA No data
Right 1202320537 Y:23628473-23628495 CCAAGGTCTCATCCTCCCATTGG No data
1202320534_1202320537 -9 Left 1202320534 Y:23628459-23628481 CCTGCTACACCAAACCAAGGTCT No data
Right 1202320537 Y:23628473-23628495 CCAAGGTCTCATCCTCCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202320537 Original CRISPR CCAAGGTCTCATCCTCCCAT TGG Intergenic
No off target data available for this crispr