ID: 1202322011

View in Genome Browser
Species Human (GRCh38)
Location Y:23645314-23645336
Sequence TCTGAAAGGCAGAAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202322006_1202322011 11 Left 1202322006 Y:23645280-23645302 CCATGGATATAACGAGAAAAAAA No data
Right 1202322011 Y:23645314-23645336 TCTGAAAGGCAGAAAGAGGAAGG No data
1202322004_1202322011 30 Left 1202322004 Y:23645261-23645283 CCTCTAAACAACTAAAACACCAT No data
Right 1202322011 Y:23645314-23645336 TCTGAAAGGCAGAAAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202322011 Original CRISPR TCTGAAAGGCAGAAAGAGGA AGG Intergenic
No off target data available for this crispr