ID: 1202322011 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | Y:23645314-23645336 |
Sequence | TCTGAAAGGCAGAAAGAGGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1202322006_1202322011 | 11 | Left | 1202322006 | Y:23645280-23645302 | CCATGGATATAACGAGAAAAAAA | No data | ||
Right | 1202322011 | Y:23645314-23645336 | TCTGAAAGGCAGAAAGAGGAAGG | No data | ||||
1202322004_1202322011 | 30 | Left | 1202322004 | Y:23645261-23645283 | CCTCTAAACAACTAAAACACCAT | No data | ||
Right | 1202322011 | Y:23645314-23645336 | TCTGAAAGGCAGAAAGAGGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1202322011 | Original CRISPR | TCTGAAAGGCAGAAAGAGGA AGG | Intergenic | ||
No off target data available for this crispr |