ID: 1202323938

View in Genome Browser
Species Human (GRCh38)
Location Y:23670532-23670554
Sequence CACCTAGAATTATCTAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202323937_1202323938 10 Left 1202323937 Y:23670499-23670521 CCTAGAAGATGCTTGAGTATTCA No data
Right 1202323938 Y:23670532-23670554 CACCTAGAATTATCTAGCCCTGG No data
1202323935_1202323938 12 Left 1202323935 Y:23670497-23670519 CCCCTAGAAGATGCTTGAGTATT No data
Right 1202323938 Y:23670532-23670554 CACCTAGAATTATCTAGCCCTGG No data
1202323936_1202323938 11 Left 1202323936 Y:23670498-23670520 CCCTAGAAGATGCTTGAGTATTC No data
Right 1202323938 Y:23670532-23670554 CACCTAGAATTATCTAGCCCTGG No data
1202323934_1202323938 15 Left 1202323934 Y:23670494-23670516 CCTCCCCTAGAAGATGCTTGAGT No data
Right 1202323938 Y:23670532-23670554 CACCTAGAATTATCTAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202323938 Original CRISPR CACCTAGAATTATCTAGCCC TGG Intergenic
No off target data available for this crispr