ID: 1202325951

View in Genome Browser
Species Human (GRCh38)
Location Y:23691553-23691575
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202325951_1202325958 0 Left 1202325951 Y:23691553-23691575 CCCAGAGGAAATCATCCTTCCCA No data
Right 1202325958 Y:23691576-23691598 TTTGTAGGCCCCTGGTTTGAAGG No data
1202325951_1202325955 -8 Left 1202325951 Y:23691553-23691575 CCCAGAGGAAATCATCCTTCCCA No data
Right 1202325955 Y:23691568-23691590 CCTTCCCATTTGTAGGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202325951 Original CRISPR TGGGAAGGATGATTTCCTCT GGG (reversed) Intergenic