ID: 1202325952

View in Genome Browser
Species Human (GRCh38)
Location Y:23691554-23691576
Sequence ATGGGAAGGATGATTTCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202325952_1202325958 -1 Left 1202325952 Y:23691554-23691576 CCAGAGGAAATCATCCTTCCCAT No data
Right 1202325958 Y:23691576-23691598 TTTGTAGGCCCCTGGTTTGAAGG No data
1202325952_1202325955 -9 Left 1202325952 Y:23691554-23691576 CCAGAGGAAATCATCCTTCCCAT No data
Right 1202325955 Y:23691568-23691590 CCTTCCCATTTGTAGGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202325952 Original CRISPR ATGGGAAGGATGATTTCCTC TGG (reversed) Intergenic
No off target data available for this crispr