ID: 1202325955 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | Y:23691568-23691590 |
Sequence | CCTTCCCATTTGTAGGCCCC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1202325951_1202325955 | -8 | Left | 1202325951 | Y:23691553-23691575 | CCCAGAGGAAATCATCCTTCCCA | No data | ||
Right | 1202325955 | Y:23691568-23691590 | CCTTCCCATTTGTAGGCCCCTGG | No data | ||||
1202325952_1202325955 | -9 | Left | 1202325952 | Y:23691554-23691576 | CCAGAGGAAATCATCCTTCCCAT | No data | ||
Right | 1202325955 | Y:23691568-23691590 | CCTTCCCATTTGTAGGCCCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1202325955 | Original CRISPR | CCTTCCCATTTGTAGGCCCC TGG | Intergenic | ||