ID: 1202325955

View in Genome Browser
Species Human (GRCh38)
Location Y:23691568-23691590
Sequence CCTTCCCATTTGTAGGCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202325951_1202325955 -8 Left 1202325951 Y:23691553-23691575 CCCAGAGGAAATCATCCTTCCCA No data
Right 1202325955 Y:23691568-23691590 CCTTCCCATTTGTAGGCCCCTGG No data
1202325952_1202325955 -9 Left 1202325952 Y:23691554-23691576 CCAGAGGAAATCATCCTTCCCAT No data
Right 1202325955 Y:23691568-23691590 CCTTCCCATTTGTAGGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202325955 Original CRISPR CCTTCCCATTTGTAGGCCCC TGG Intergenic