ID: 1202331158

View in Genome Browser
Species Human (GRCh38)
Location Y:23754517-23754539
Sequence AATTCTTTGAAGGAGCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202331158_1202331162 30 Left 1202331158 Y:23754517-23754539 CCTTGCAGCTCCTTCAAAGAATT No data
Right 1202331162 Y:23754570-23754592 ACTACAAAATACCCAGGACATGG No data
1202331158_1202331161 24 Left 1202331158 Y:23754517-23754539 CCTTGCAGCTCCTTCAAAGAATT No data
Right 1202331161 Y:23754564-23754586 AACTTTACTACAAAATACCCAGG No data
1202331158_1202331160 -4 Left 1202331158 Y:23754517-23754539 CCTTGCAGCTCCTTCAAAGAATT No data
Right 1202331160 Y:23754536-23754558 AATTTGTCACATATGAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202331158 Original CRISPR AATTCTTTGAAGGAGCTGCA AGG (reversed) Intergenic
No off target data available for this crispr