ID: 1202332424

View in Genome Browser
Species Human (GRCh38)
Location Y:23768860-23768882
Sequence CACTTGTCCCAGAGGCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202332421_1202332424 -1 Left 1202332421 Y:23768838-23768860 CCTTTGAAGAATCTCCAAGGAAC No data
Right 1202332424 Y:23768860-23768882 CACTTGTCCCAGAGGCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202332424 Original CRISPR CACTTGTCCCAGAGGCCCTG AGG Intergenic
No off target data available for this crispr