ID: 1202339663

View in Genome Browser
Species Human (GRCh38)
Location Y:23849811-23849833
Sequence CAAGCTGATAAAATTGCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202339657_1202339663 28 Left 1202339657 Y:23849760-23849782 CCTGCAGGGGCAACAGTGAAGTT 0: 3
1: 3
2: 0
3: 26
4: 258
Right 1202339663 Y:23849811-23849833 CAAGCTGATAAAATTGCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202339663 Original CRISPR CAAGCTGATAAAATTGCTAT TGG Intergenic
No off target data available for this crispr