ID: 1202349471

View in Genome Browser
Species Human (GRCh38)
Location Y:23972432-23972454
Sequence CACTTGTCCCAGAGGCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202349466_1202349471 18 Left 1202349466 Y:23972391-23972413 CCATTGCTTTAAATAGGGTCCTT No data
Right 1202349471 Y:23972432-23972454 CACTTGTCCCAGAGGCCCTGAGG No data
1202349468_1202349471 -1 Left 1202349468 Y:23972410-23972432 CCTTTGAAGAATCTCCAAGGAAC No data
Right 1202349471 Y:23972432-23972454 CACTTGTCCCAGAGGCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202349471 Original CRISPR CACTTGTCCCAGAGGCCCTG AGG Intergenic
No off target data available for this crispr