ID: 1202349471 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | Y:23972432-23972454 |
Sequence | CACTTGTCCCAGAGGCCCTG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1202349466_1202349471 | 18 | Left | 1202349466 | Y:23972391-23972413 | CCATTGCTTTAAATAGGGTCCTT | No data | ||
Right | 1202349471 | Y:23972432-23972454 | CACTTGTCCCAGAGGCCCTGAGG | No data | ||||
1202349468_1202349471 | -1 | Left | 1202349468 | Y:23972410-23972432 | CCTTTGAAGAATCTCCAAGGAAC | No data | ||
Right | 1202349471 | Y:23972432-23972454 | CACTTGTCCCAGAGGCCCTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1202349471 | Original CRISPR | CACTTGTCCCAGAGGCCCTG AGG | Intergenic | ||
No off target data available for this crispr |