ID: 1202358013

View in Genome Browser
Species Human (GRCh38)
Location Y:24072467-24072489
Sequence GACAGCTCTTGGCCCATTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202358013_1202358018 16 Left 1202358013 Y:24072467-24072489 CCAGCAATGGGCCAAGAGCTGTC No data
Right 1202358018 Y:24072506-24072528 GTTATCTGCAGAAAATGGCAGGG 0: 12
1: 195
2: 171
3: 143
4: 299
1202358013_1202358016 11 Left 1202358013 Y:24072467-24072489 CCAGCAATGGGCCAAGAGCTGTC No data
Right 1202358016 Y:24072501-24072523 TACTAGTTATCTGCAGAAAATGG No data
1202358013_1202358017 15 Left 1202358013 Y:24072467-24072489 CCAGCAATGGGCCAAGAGCTGTC No data
Right 1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202358013 Original CRISPR GACAGCTCTTGGCCCATTGC TGG (reversed) Intergenic
No off target data available for this crispr