ID: 1202358017

View in Genome Browser
Species Human (GRCh38)
Location Y:24072505-24072527
Sequence AGTTATCTGCAGAAAATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202358013_1202358017 15 Left 1202358013 Y:24072467-24072489 CCAGCAATGGGCCAAGAGCTGTC No data
Right 1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG No data
1202358014_1202358017 4 Left 1202358014 Y:24072478-24072500 CCAAGAGCTGTCTCTCCAAAGAA No data
Right 1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG No data
1202358011_1202358017 22 Left 1202358011 Y:24072460-24072482 CCAAAGCCCAGCAATGGGCCAAG No data
Right 1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG No data
1202358012_1202358017 16 Left 1202358012 Y:24072466-24072488 CCCAGCAATGGGCCAAGAGCTGT No data
Right 1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202358017 Original CRISPR AGTTATCTGCAGAAAATGGC AGG Intergenic
No off target data available for this crispr