ID: 1202358290

View in Genome Browser
Species Human (GRCh38)
Location Y:24074976-24074998
Sequence GCTTTCAGCAGATACTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202358290_1202358300 28 Left 1202358290 Y:24074976-24074998 CCACCACAGTATCTGCTGAAAGC No data
Right 1202358300 Y:24075027-24075049 GTGAGGAGCTACCCAGTCGAGGG No data
1202358290_1202358299 27 Left 1202358290 Y:24074976-24074998 CCACCACAGTATCTGCTGAAAGC No data
Right 1202358299 Y:24075026-24075048 AGTGAGGAGCTACCCAGTCGAGG No data
1202358290_1202358297 11 Left 1202358290 Y:24074976-24074998 CCACCACAGTATCTGCTGAAAGC No data
Right 1202358297 Y:24075010-24075032 TGGGATGACCAGCTAGAGTGAGG No data
1202358290_1202358295 -9 Left 1202358290 Y:24074976-24074998 CCACCACAGTATCTGCTGAAAGC No data
Right 1202358295 Y:24074990-24075012 GCTGAAAGCTGGGGAGATAATGG No data
1202358290_1202358296 -8 Left 1202358290 Y:24074976-24074998 CCACCACAGTATCTGCTGAAAGC No data
Right 1202358296 Y:24074991-24075013 CTGAAAGCTGGGGAGATAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202358290 Original CRISPR GCTTTCAGCAGATACTGTGG TGG (reversed) Intergenic
No off target data available for this crispr