ID: 1202358328

View in Genome Browser
Species Human (GRCh38)
Location Y:24075251-24075273
Sequence GTGGAGAGACGGCTTTAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202358328_1202358332 14 Left 1202358328 Y:24075251-24075273 CCACTCTAAAGCCGTCTCTCCAC No data
Right 1202358332 Y:24075288-24075310 TCATCAGAACATCCAGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202358328 Original CRISPR GTGGAGAGACGGCTTTAGAG TGG (reversed) Intergenic
No off target data available for this crispr