ID: 1202360030

View in Genome Browser
Species Human (GRCh38)
Location Y:24097937-24097959
Sequence AAATTCCAACAGATACACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202360030_1202360034 12 Left 1202360030 Y:24097937-24097959 CCTGGGTGTATCTGTTGGAATTT No data
Right 1202360034 Y:24097972-24097994 ATCTTTGAATCAGTGAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202360030 Original CRISPR AAATTCCAACAGATACACCC AGG (reversed) Intergenic
No off target data available for this crispr