ID: 1202367280

View in Genome Browser
Species Human (GRCh38)
Location Y:24174062-24174084
Sequence TCTTGCTGCTGCCGCAGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202367280_1202367286 25 Left 1202367280 Y:24174062-24174084 CCAAGTCTGCGGCAGCAGCAAGA No data
Right 1202367286 Y:24174110-24174132 GCCCTGATCCCACAGGAGCTTGG No data
1202367280_1202367282 1 Left 1202367280 Y:24174062-24174084 CCAAGTCTGCGGCAGCAGCAAGA No data
Right 1202367282 Y:24174086-24174108 CAGTACCTGTGTACCGCTCTAGG No data
1202367280_1202367285 18 Left 1202367280 Y:24174062-24174084 CCAAGTCTGCGGCAGCAGCAAGA No data
Right 1202367285 Y:24174103-24174125 TCTAGGAGCCCTGATCCCACAGG No data
1202367280_1202367288 26 Left 1202367280 Y:24174062-24174084 CCAAGTCTGCGGCAGCAGCAAGA No data
Right 1202367288 Y:24174111-24174133 CCCTGATCCCACAGGAGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202367280 Original CRISPR TCTTGCTGCTGCCGCAGACT TGG (reversed) Intergenic